Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ILV5
Systematic Name YLR355C
Strain S288c
Description Bifunctional acetohydroxyacid reductoisomerase and mtDNA binding protein; involved in branched-chain amino acid biosynthesis and maintenance of wild-type mitochondrial DNA; found in mitochondrial nucleoids
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ILV5 YLR355C
TTGTAAGTGAACAAGGGACCTCTTTTGCCTTTCAAAAAAGGATTAAATGGAGTTAATCAT
TGAGATTTAGTTTTCGTTAGATTCTGTATCCCTAAATAACTCCCTTACCCGACGGGAAGG
CACAAAAGACTTGAATAATAGCAAACGGCCAGTAGCCAAGACCAAATAATACTAGAGTTA
ACTGATGGTCTTAAACAGGCATTACGTGGTGAACTCCAAGACCAATATACAAAATATCGA
TAAGTTATTCTTGCCCACCAATTTAAGGAGCCTACATCAGGACAGTAGTACCATTCCTCA
GAGAAGAGGTATACATAACAAGAAAATCGCGTGAACACCTTATATAACTTAGCCCGTTAT
TGAGCTAAAAAACCTTGCAAAATTTCCTATGAATAAGAATACTTCAGACGTGATAAAAAT
TTACTTTCTAACTCTTCTCACGCTGCCCCTATCTGTTCTTCCGCTCTACCGTGAGAAATA
AAGCATCGAGTACGGCAGTTCGCTGTCACTGAACTAAAACAATAAGGCTAGTTCGAATGA
TGAACTTGCTTGCTGTCAAACTTCTGAGTTGCCGCTGATGTGACACTGTGACAATAAATT
CAAACCGGTTATAGCGGTCTCCTCCGGTACCGGTTCTGCCACCTCCAATAGAGCTCAGTA
GGAGTCAGAACCTCTGCGGTGGCTGTCAGTGACTCATCCGCGTTTCGTAAGTTGTGCGCG
TGCACATTTCGCCCGTTCCCGCTCATCTTGCAGCAGGCGAAATTTTCATCACGCTGTAGG
ACGCAAAAAAAAAATAATTAATCGTACAAGAATCTTGGAAAAAAAATTGAAAAATTTTGT
ATAAAAGGGATGACCTAACTTGACTCAATGGCTTTTACACCCAGTATTTTCCCTTTCCTT
GTTTGTTACAATTATAGAAGCAAGACAAAAACATATAGACAACCTATTCCTAGGAGTTAT
ATTTTTTTACCCTACCAGCAATATAAGTAAAAAATAAAAC
Chr coordinates Chr XII from 839253-838066
w3c xhtml validator w3c css validator