Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ADE13
Systematic Name YLR359W
Alias BRA1, BRA8
Strain S288c
Description Adenylosuccinate lyase, catalyzes two steps in the 'de novo' purine nucleotide biosynthetic pathway; expression is repressed by adenine and activated by Bas1p and Pho2p; mutations in human ortholog ADSL cause adenylosuccinase deficiency
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ADE13 YLR359W
AACTATCCAGTTTAAGATATAACAGGTCATCTATGTCTTTAGAAAACCAAAATGCTATTG
GCCAGCAACAAATACCACTGTCAAGAGTTGGTTCCCCTGGCGCGGGAGGCCCGCTTACTG
TACAAGGTTTAAAGCAACACCAATTGCAAAGGTTACAACAGCAGCAACATCAATACCAAC
AACAGAAAAGATCCCAAGCATCACGTTATAATATCCCAACAATAATCGATGATTTAACAT
CGCAGGCATCAAGAGGTAATTTGGGTAATATAATGATCGATGCAGCCTCCTCGTTTGTCT
TACCTATCTCTATAACCAAAAACGTAGATGTTTTGCAGCGTACTGATCTGCACAGCCAAA
CCAAGAGATCTGGAAGAGAAGAGATGTTTCCATGGAAAAAAACAAAGGGTGAAATATTAT
GGTTCAGAGGACCTAGTGTGATAGTAAATGAACGAATAATAAATTCAGGTGACCCACACC
TAAGCCTGCCACTGAATAGGTGGTTTACCACTAACAAGAAAAGAAAACTAGAATACGAAG
AAGTTGAAGAAACCATGGAAGATGTGACTGGAAAGGACAAAGATGATGATGGCTTAGAAC
CGGATGTTGAAAATGAGAAAGAGTCCTTGCCAGGCCCATTTGTCCTTGGATTAAGACCCT
CGGCTAAGTTCACGGCGCACAGACTCTCTATGCTGCGGCCTCCTTCGTCGTCTTCATGAT
CACCTTTATTGTAAAAGCAATGGCAGCATAATATCTTCCCATTGCGCATTACCCTCCGCG
AGCAGAGTCAAACTTCAAACAAAGCAGGAAAATGAAATAAAACAGAAGTTATTATATAGA
AGAAAGTCATCTATAGATATATTATCGTTGTATTAATAGTAGCCATATAAAACAATTATA
CTTCATCACCAACCTCTCAAAATTTCTTCCCCAAGGACCAAAGCTTTTCCAGTAAGTTGC
TACAACTAAAGTGAAATAAACTATCCGAATTATATAAAAG
Chr coordinates Chr XII from 844282-845730
w3c xhtml validator w3c css validator