Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPS22B
Systematic Name YLR367W
Alias rp50, S22B, S24B, S8, uS8, YS22
Strain S288c
Description Protein component of the small (40S) ribosomal subunit; nearly identical to Rps22Ap and has similarity to E. coli S8 and rat S15a ribosomal proteins
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS22B YLR367W
ACTGCAACTATTCTTACAATCTTTCATTTACATGGCTCAAGAAGTGTTGCTGCTCAAAAT
TTCATTCTATTTCATGATTATTTACATTAAACAAGTATGATCCGTTATTCTTCTCGCAAC
CGGAGTGCTCGAGAAGTGCCAGTAAGACGACACCCTATTTTTCAAGTCCAGCATTGGAAG
ACTTCCAATGAACACTCTTATCATTATTCTTTATGCATTACGTTTCGCAGTAATCCTAGA
ACCCTAACTTTTTCTAAAATTACCGTCAAAAATGACGGACGCAACTTTTCTCAGAAATTT
TTTTTTTCATTTCTCTTAAAAAGTTTTCTACGCTGGATAAATTGTTCTCTTCCCTTTGAA
ATATGGAGACGTTCAAAGTCAATTTCCACACATTTAAGGTGAACAAATAAATTATAAGAT
ACCACATTAACAACAAGTATGTGGACGAGGTGTGGTAAGATCTCCGCTGAGGTTGATTGA
AAAGTATTGGGTAAATTTGTACTTTTTGTCTGCTGCTGGTCGTTTGTCTTTCGTTTTAAA
ATTGCGCTAGACAAGTAAACAGGGATTGCTTAAGAATCAAAGTAGCTTAACTCTAAAGTA
TTATTTTCCTCAGTTGTGGGCCCATGTGTTGGAGGGAAGGAATATATTGAAATGTAAATG
TTCTTAAGTTCGGTTGAACTTGGATATTGTTACAAGAGTTCTAGTCTTTGATACCATTTT
TACGCAATTACAACCGCATTATTTACCTTTTCATCTTCAGTTTTACGGTTCAGTTTATTC
TGTTACGAAAGAACTATGGTGATTCAAAGGCGAAGTGCGTAGGATTGTAACTCCTATATC
TTTAGGATACTTACAATTTTGTACTGTTTTCAAGACCACTGTAACCGATAATAAACCGGA
GGACACATTTTAACCCACTATTTTTTTCAGAAGATCAGATGCGAGAGCTCGAAGCATAAG
TATAATACTAACGTTTCAAAACATAGTAATTAGGTAAAAA
Chr coordinates Chr XII from 856442-856574,857058-857317
w3c xhtml validator w3c css validator