Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name Uncharacterized
Systematic Name YLR374C
Strain S288c
Description Dubious open reading frame; unlikely to encode a functional protein, based on available experimental and comparative sequence data; partially overlaps the uncharacterized ORF STP3/YLR375W
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YLR374C	6323407 upstream sequence, from -1000 to -1, size 1000
CCGCACTTGAAGAATGATAAGAGAAGGAAAAAAAACATTAAAAACTCAGATACATAAATT
AAATATCTACTAGTACTAATAAAAACAGGGGAAAAGTCGTTATGCTGCCGGGAATCAATG
GTATTTATAGCCGCATTGTTTACCTACGTGTTCGTTGAGCCAAACGTCAACGTTCTCGAA
CTTCAGGCCGCAATGCTTACATCTACCAGGAACAACATTTCTATCCTTTTTCTTCGTGCC
TGGCGGGTATTCAAAATGCAAAGCCTTTAAATGGTTTTTGAAGGTGTCGCAACGTGAGAA
CACCCCCGTCTGGTGACAATTGGAAGTCTCAAAATTTAAAGGTTTCAGTTTATACGGGTA
CATATCCATGTCCAATTGTATTAAGGTGGAGTTGAATGGGCACTTGAATGTGCCCTTGAT
TTGATGCAACGATTTCAATTGTGCATAATCTGTGACAGAATTCATCGGTGTCATTTTTTC
ATGGGTATCATCATCATTGGGAGAAACGGATCCTCCCTTACCATCATTATGGTTCGAAAG
TACTCCCGATTGGGACAGTATCTCATCCTTCCAATGTCTTTTCTTATGCCTCAATAAGTC
ATTGTTCCTGGCGAACCCGCGGTGGCAGATGGGACACTTGTGAGGCCGATCCTCTGGCGT
CAAGTGCGTTGCCTTGTGCGTGGTCAGATTGGCATAAAAATTACGACAAATTGGACATTG
CTTCTTTTTCCTTGGCTTATTGATTTTGGTGCTATGGGGGGTACTCACCCCGGCACCGCC
AACAGATGAAGGACCAGCCACTTTTAAAATTGGTGAAATGGAACGTGAAGGTGATGCAGA
TGAAGAAGTTTCCGATGCAGAAGCGGAACCTTCCGTAGGCTGCTGCACGGAGGGAAGGAA
GCTCGAGCTGGAGTTCGACCGGGACACATCATTGGAGTGCGGAAGCAACTGATAGCTCAG
CATCGACGATGATGCGCCCGCACTGCCACTGCCGTTACTA
Chr coordinates Chr XII from 871842-871453
w3c xhtml validator w3c css validator