Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name STP3
Systematic Name YLR375W
Strain S288c
Description Zinc-finger protein of unknown function; possibly involved in pre-tRNA splicing and in uptake of branched-chain amino acids; STP3 has a paralog, STP4, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>STP3 YLR375W
ATAGCATTCAGAATTAAGTCATGGTCAATGAAGCTTAGTGAGTTGGCGTTCTGATTGATC
AAAAGGCGTACGGCAGTGTTGTCTACGAACGACAGAGGCAAGTTTTCTGATGCAATTATG
ATCGCAAGCGACTGCACAAGAGGCAAGGCCATTTCTTTTTCCCTAGTTCTCTTCAAAAAG
TCCTCGTCTATTTCCAGCAGGTTAGCAATGCTGTTCGTTGTGGCGCTACCGCCTTGATGG
TTCTTCAAAGGTGGTCTGACCATAAAAGTAGAACCTGCTTCTACGCCCGTCCATCCGCTA
TAGTAATTGGCATTCGGGTCTATCTTATGCGTGCTCCACAAATGAGTTTGCGAGGCTTCC
GCCATGCTTATGCTGTTTCCTTGCCGTCTTATTATCACACCGCAGTACTTGCATTTTACT
GCCTCCAGCATCTTGTCTACACCCAGAAAATGGCCCAAGTAGCGTGACCTGTCTCTGGTA
AGCATATATGCGGGCACCCATTCGCTACCATCCTCTGCTAACGACTCCCTTTCCTCATCT
CTATCTCCATCTGTATCTGTATCCGTATTTGTGGCCGTCGTAGCCGCCGTCGCCGACGAT
ACAGTTGAATTCATGGGAGGCAACACCAATCCTCTTTCAGCACTCTGTACCTGTGTGTCC
ATCGCTCTCATATGTGCTCTCGTGCTTGTTTATCCTGTGGATGCTGCCAGCAAACTCTCT
CTTTCCCATCTCTTGATGGTTCATGTTATGTGTTGTTTATTGTTTGCTGATCCCATTCGC
GCTTTCCCGGCCGTGGTAAATGACTACACGGTGAATAATTGCGCCATTTTTTCGCCGTTG
CGGTGTTTTTTTTGTAGCCGTTGGAAGCATGGCAGTACCATCTGGAACAAAGCAACGGTA
TAAAGAAGACAGACTGTTGGTAAGCGCTGCATGTTGGTGACAAAAAGTTGGTTTCGAGAA
ATCAGGGTGGGTGTTTTTTGTGTGGCATGTGCAGCGAGCG
Chr coordinates Chr XII from 871697-872728
w3c xhtml validator w3c css validator