Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name STP3
Systematic Name YLR375W
Strain S288c
Description Zinc-finger protein of unknown function; possibly involved in pre-tRNA splicing and in uptake of branched-chain amino acids; STP3 has a paralog, STP4, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>STP3 YLR375W
ATGAGTAATGCAAACAATAGTGCTATGAACCACATCACGTTGCCTCCCATCTCGTCATTT
GACAACCTTATCAAGGCAGCCGAGAGACAATATAATGGCGAGGCTTCGTCCGCCTCGACA
CATCCGACACTGCCTAATATGAACATTAGTAACGGCAGTGGCAGTGCGGGCGCATCATCG
TCGATGCTGAGCTATCAGTTGCTTCCGCACTCCAATGATGTGTCCCGGTCGAACTCCAGC
TCGAGCTTCCTTCCCTCCGTGCAGCAGCCTACGGAAGGTTCCGCTTCTGCATCGGAAACT
TCTTCATCTGCATCACCTTCACGTTCCATTTCACCAATTTTAAAAGTGGCTGGTCCTTCA
TCTGTTGGCGGTGCCGGGGTGAGTACCCCCCATAGCACCAAAATCAATAAGCCAAGGAAA
AAGAAGCAATGTCCAATTTGTCGTAATTTTTATGCCAATCTGACCACGCACAAGGCAACG
CACTTGACGCCAGAGGATCGGCCTCACAAGTGTCCCATCTGCCACCGCGGGTTCGCCAGG
AACAATGACTTATTGAGGCATAAGAAAAGACATTGGAAGGATGAGATACTGTCCCAATCG
GGAGTACTTTCGAACCATAATGATGGTAAGGGAGGATCCGTTTCTCCCAATGATGATGAT
ACCCATGAAAAAATGACACCGATGAATTCTGTCACAGATTATGCACAATTGAAATCGTTG
CATCAAATCAAGGGCACATTCAAGTGCCCATTCAACTCCACCTTAATACAATTGGACATG
GATATGTACCCGTATAAACTGAAACCTTTAAATTTTGAGACTTCCAATTGTCACCAGACG
GGGGTGTTCTCACGTTGCGACACCTTCAAAAACCATTTAAAGGCTTTGCATTTTGAATAC
CCGCCAGGCACGAAGAAAAAGGATAGAAATGTTGTTCCTGGTAGATGTAAGCATTGCGGC
CTGAAGTTCGAGAACGTTGACGTTTGGCTCAACGAACACGTAGGTAAACAATGCGGCTAT
AAATACCATTGA
Promoter Sequence
Download FASTA
>STP3 YLR375W
ATAGCATTCAGAATTAAGTCATGGTCAATGAAGCTTAGTGAGTTGGCGTTCTGATTGATC
AAAAGGCGTACGGCAGTGTTGTCTACGAACGACAGAGGCAAGTTTTCTGATGCAATTATG
ATCGCAAGCGACTGCACAAGAGGCAAGGCCATTTCTTTTTCCCTAGTTCTCTTCAAAAAG
TCCTCGTCTATTTCCAGCAGGTTAGCAATGCTGTTCGTTGTGGCGCTACCGCCTTGATGG
TTCTTCAAAGGTGGTCTGACCATAAAAGTAGAACCTGCTTCTACGCCCGTCCATCCGCTA
TAGTAATTGGCATTCGGGTCTATCTTATGCGTGCTCCACAAATGAGTTTGCGAGGCTTCC
GCCATGCTTATGCTGTTTCCTTGCCGTCTTATTATCACACCGCAGTACTTGCATTTTACT
GCCTCCAGCATCTTGTCTACACCCAGAAAATGGCCCAAGTAGCGTGACCTGTCTCTGGTA
AGCATATATGCGGGCACCCATTCGCTACCATCCTCTGCTAACGACTCCCTTTCCTCATCT
CTATCTCCATCTGTATCTGTATCCGTATTTGTGGCCGTCGTAGCCGCCGTCGCCGACGAT
ACAGTTGAATTCATGGGAGGCAACACCAATCCTCTTTCAGCACTCTGTACCTGTGTGTCC
ATCGCTCTCATATGTGCTCTCGTGCTTGTTTATCCTGTGGATGCTGCCAGCAAACTCTCT
CTTTCCCATCTCTTGATGGTTCATGTTATGTGTTGTTTATTGTTTGCTGATCCCATTCGC
GCTTTCCCGGCCGTGGTAAATGACTACACGGTGAATAATTGCGCCATTTTTTCGCCGTTG
CGGTGTTTTTTTTGTAGCCGTTGGAAGCATGGCAGTACCATCTGGAACAAAGCAACGGTA
TAAAGAAGACAGACTGTTGGTAAGCGCTGCATGTTGGTGACAAAAAGTTGGTTTCGAGAA
ATCAGGGTGGGTGTTTTTTGTGTGGCATGTGCAGCGAGCG
Chr coordinates Chr XII from 871697-872728
w3c xhtml validator w3c css validator