Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CCW14
Systematic Name YLR390W-A
Alias ICWP, SSR1, YLR391W, YLR391W-A
Strain S288c
Description Covalently linked cell wall glycoprotein, present in the inner layer of the cell wall
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CCW14 YLR390W-A
TGATTTCACTTTCTCTGATTCATTCAGGAAGAAAAGGGCGAAGTCCTCGAAATGAAAATT
TCAACATCATTAACAGACCGGCGCGCGCCTTTACAATTTAGTATGTACGCCACCAATAAA
AGCTGCTTAAACAATAAGCTAGAAAGCCCAAAGGGTGTTAAATAGTACAGCGAACCCTTC
AGCAACGGTACATCAACAACCCCTTGAAAAGAATAGAGACAATACAGCTACAGTCATCCC
CTTCTCTTGTATTTTTGGCCACAATTGATTGTATTACATCATATTTTGCCTGTGCGCTTC
TTCTATCTTTTCCGCATAAACTAGGGGAAACGCGATGAAGAAATGGATTGGCTGAAAAAT
ACAACAATTGTAGTGTTATTCAGTCATTCAACTGACAAAAGTAACAAACACAAGAAACGT
CAAGTCCAGTGCAATATGCGAAAGAACACTTTAGATATGGTCACTATAGGTATCGCATGC
CTTGTGGGAGTCTACACGGGCACGAGATTTTTCGAGCCCATTGTTATCGATAGATTGCGT
AAGGATGGAAACTTGAGAACGGACATTCCCATCCCAGAATACGACGAGGACGGAAATCTG
TTAAAGGTCACGCCGTCTTTATCATCCACACCAGCTGCACCACCTACACCACCTACACCT
CCTACTCCACCACAACAGTAAGGAAGCGTACTAGAAAATACCTCTATACTTTCTTTTCCT
GTATATAGCATCAATAGTAAAGCCATTATAACGTTACAAAAACCTATTACCCGGAAAATT
ACTATTTATAGAAGCATTGGACCCATGCACCACATGCATTAGGACCCATTATTTCTTTTT
TACAATTTTTCCGTTAATTTTTCACGAATTTTTCACCGTTTATAAACACTCTCGAACTTA
TAAACAAAGGGATGATAAATAGATTTCGCCAGTTGTTAATACACACAGGGTCAAAGCTCA
CAGCACTACTACACTCGTTCAACACTCGTTATATATTATC
Chr coordinates Chr XII from 903724-904440
w3c xhtml validator w3c css validator