Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PUN1
Systematic Name YLR414C
Strain S288c
Description Plasma membrane protein with a role in cell wall integrity; co-localizes with Sur7p in punctate membrane patches; null mutant displays decreased thermotolerance; transcription induced upon cell wall damage and metal ion stress
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PUN1 YLR414C
GCCCCTCTGTCGCTGTAGAATCTTAGATTTGCCATGGTAAAGACCTACGGACTGATCGAT
AAAGATATCTTTTTCACCTTCTCGAAGAAGAGGTTGGCCCGATGACGTAGTTTCCACATA
ATGCCAGTACTCCATCTTTTGAAAAAAAAAGAATGACTTTCAAAACACACTTCCTGATTC
CTAGCCGAGGTCCCCTATTCTATCTTGGATGACCTTTTCTCTGCTTTTTTGTTTTTCAGT
CTCCATCTTTTCCAGATGAAACATGTGAAACCCTTTTTCCTCTTCGTTGATCCTAAAAAA
AGCGCGTCTGGAAAACAAGGCGAAGCTTCCTCACATGGAAAAGGCTTCTTAATATGTCGC
TACGCCTCATTCCCATTGCATACAGAAAGCAAAGTAGTGCGTTTTGCGAACGTCACAGAT
CAAAAGTTTGGCCATGCATTGTCATTCTTTTTTTCTTACATACACTGCACCAGACATGTC
GGTTCCGCCCCGCTAACGGTTAGTCAGCCACACATTGACGTACACTGTGAACAGCCTATT
TCTTTCCATGTATCTCAGTGCCCAGCTTATGAGAACTGTCACAGCCTCCCACTTGACCCT
CAGAGCCCTCTCCACTCCCCCCCTCTTTCAACATCGCCAGATAGCCGCCGTTGAATGGTG
CGGGACAACCCGGCCTGGCCTGGCCAGGCAAAAAAGGACGCAGCACGCCTCGAGCGTTAT
TTCCAAATCGGGCGTACTATCAGCCAAGCCCAGCTCGGTATTTTTAGCGCTTCTCGCAGG
AAAATTGGCTGAGAAGTATATATACGCGAGAATGTTGCTCTTCCATGTCTCAGTAGTCAA
TGAGTGTCCAGTGGTGTTTCATTCTGGACCAGTTGTTTGGAAGTAGAACTAAAAGAAACT
AGATCAAGATCATACAACGCTGCGCAGTAGTGAAACTTGATTAAAGCAATAGAGAACTAT
TAAGAAAAAAACAAACACATCATCGAAGGACGCTATAAGC
Chr coordinates Chr XII from 954144-953353
w3c xhtml validator w3c css validator