Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YLR415C
Systematic Name YLR415C
Strain S288c
Description Putative protein of unknown function; YLR415C is not an essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YLR415C YLR415C
ATTTCCTATTTGAGGATGATTAGCAAAAGTACAGGCGGGGCAAATGTTCTCAGAGTTCAC
TCCGAACTGATTCTGTGGGTTGGCGTTCGGGTCGATTGCATTAGAACAATTTATAGACGA
CTTGGTGAGCTCATAGTCCGCTGGCACACCGCAATTGATACAAATGGGTGTAGGTAGAGT
GTCTTTAGTGAATTCCCCCTGCGTTTCGTTCGAAACCATACAGATGGGGCAGACCCACGT
CGAAACAACGTCGGCACTTGCTGTTTCCGCACTTTTACCAAGTTCATCCTTACTGGAGGG
GTCCTTGAAAAACAGGATCAGACGAGGTGATCTGGTCAAGAAGCCAGATGAATAGTTTAC
ATACGCTAGATCGTCCAATTCCAACCCAAGCGAGTTCTGAGTGGGCTTTGCATCGTCGAT
GTAGATAATTCTTTGTGACGTTAAAAAGATTCTGCCCCTCTGTCGCTGTAGAATCTTAGA
TTTGCCATGGTAAAGACCTACGGACTGATCGATAAAGATATCTTTTTCACCTTCTCGAAG
AAGAGGTTGGCCCGATGACGTAGTTTCCACATAATGCCAGTACTCCATCTTTTGAAAAAA
AAAGAATGACTTTCAAAACACACTTCCTGATTCCTAGCCGAGGTCCCCTATTCTATCTTG
GATGACCTTTTCTCTGCTTTTTTGTTTTTCAGTCTCCATCTTTTCCAGATGAAACATGTG
AAACCCTTTTTCCTCTTCGTTGATCCTAAAAAAAGCGCGTCTGGAAAACAAGGCGAAGCT
TCCTCACATGGAAAAGGCTTCTTAATATGTCGCTACGCCTCATTCCCATTGCATACAGAA
AGCAAAGTAGTGCGTTTTGCGAACGTCACAGATCAAAAGTTTGGCCATGCATTGTCATTC
TTTTTTTCTTACATACACTGCACCAGACATGTCGGTTCCGCCCCGCTAACGGTTAGTCAG
CCACACATTGACGTACACTGTGAACAGCCTATTTCTTTCC
Chr coordinates Chr XII from 954597-954259
w3c xhtml validator w3c css validator