Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CDC73
Systematic Name YLR418C
Strain S288c
Description Component of the Paf1p complex; binds to and modulates the activity of RNA polymerases I and II; required for expression of certain genes, modification of some histones, and telomere maintenance; involved in transcription elongation as demonstrated by the G-less-based run-on (GLRO) assay
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CDC73 YLR418C
CGTGCAACTTGTTCTTTCTGTGCTTGATTATTCTGGGCCACTTGTTCTTTTTCACGTTGG
GCTTTGAGCTTTCTGTCTTCCACCATTGTCTTGAAGGGATCAAGATCAAATAGTTTGTTT
ATACGCTTTTCGTCTGTTTTCAGGTTATCTTTTCGAAAATCGTCGAGGGCATACCATGTT
TTTCTATGGTTTGGCGGAAGCATCATGTGCAGGTTGGTGTTGTATGCAATGCGATATAGC
GCAATAGTGGAGGCCATGTGTCTAGCTTCAATTGGAGTTTCTTGAGGAATTACAAGGCCT
TTTCCTGAAGCTTTGTCATAGGTTGGATCGTTCATTCTTGCAGTCAATGTTTCTTTTGTC
TTTGGGTCAGTGAATGACAAAACTGCAATTGCAATGAAACCTTTATCACCGATTTTCTTC
ATATCATACTCTACCTTATTCCATTTTCGTTTCTGACATGTTTCGTGTAAGATTGTATGA
GGCAATTTACCTGTCCAGCTTGCTGTGGATGTCACTTTTGCTCTATTACTTTGTTGCTTG
GCCCTTTTGTCATCTTCTGGCTCTGGTTCTTGTCCCTTTTTTCCTTTTGCTTTCTTTTTG
CCAGCAGTTGTTGGTACATCATTCACTGGAGTTGAACTTTTTGAGTTATTTTTCGTTTTT
TTGGCCATTTATCAAAAATTAATGAAAGCAATTGCGATGTAAAGTATAAAGTGAATGATT
ATTGTTAATACTTCCCTTAGCTAAGAGTCTCTTTTACAACTTTGAATAGTATGTATCTTT
TTAGTGTATAATTTTTCAACTCATCGAACACCGAGACGGTTAACCGGCAACGCAATATTG
TTCTCAAAGCATAAGGATGAAAATTTCGATTGGACAGGTTTAAAACAAGTACTTCAACGA
ATATTCCACCCTTTTTCAAATTGCGTTTCCAAAACAGGCTGTTTCTTAATTCGGGGCGTT
AAAAGAATAATAATTTGAGCAAGAAACTGGTGAAAAAATT
Chr coordinates Chr XII from 958095-956914
w3c xhtml validator w3c css validator