Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SEN1
Systematic Name YLR430W
Alias CIK3, NRD2
Strain S288c
Description Presumed helicase required for RNA polymerase II transcription termination and processing of RNAs; homolog of Senataxin which causes Ataxia-Oculomotor Apraxia 2 and a dominant form of amyotrophic lateral sclerosis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SEN1 YLR430W
AAAGCTTACCTCAAGAAGAGAAGTCCTCTGAGAAAACAAAGTCCCCTGAGCAGGAAAAAT
CCGCAACACCTCCTTCTTCAATTACGGCTGCTAAGACAGCCATTACTGCCAGCAGTAAGG
AAGAGCCATCCGCGGCAAGGACATCACCTAAGTCATTGGGTTTAAAAAAGTCTGTCGAAA
AACTATCTACATTGGTTCTGCAATTAGAAGATGTAGTTGATAAATTAACGAAAGCAAATC
TTGACAAAGATGAGCGCCTGTTAAAGTTGGAACAAAAAATTGGCGAACTGTCAAAATGAA
AATTTTTTGTACTTTTAATGATAAAATTAAGTGAGTCCTTTTTATAGGAAAGATGTATTT
TGATTATATGTAATGTACATAAGACGGCGGCGATAATAATGCACTTAGAAAGTGAATCAT
GTTCACCTGTCCACTAACAAAAAAGGAAACAAAATGTTGCTTTCCCACAGGAAAAAGAAT
GTTTTTGACAAAACACTAAGCGTTATGTGACCAATGTATAATTGTCCTCATCATATAGTT
TTATGCAAGCATAAATAAGTCTTTCTTTTAGTTAAAACGCGTTACATAGTAAAGGTAACC
CTGAATGAATTTTTATTTATATTTTTCTTCGCATATTTTAGGATCTTGAAAAATTAACCA
CAAGTTAGAAGTTGATGAGATCAGGAATTCTAACAAAAGGTCATTGGTTAGGTTTATTTT
GTAGGTGCACGTTTGCAACTTTATTCCTTTTGTTTCAAAGTTATAGAGCTTTCATTTTCT
CATTCTTCTCTAGTGTAGGTCATTTCTCCTGCATATTAACCTACTAGAAAAGTTTACGAA
GCTTCATAGGAACGAATAATCGATCACTTTAAAGGCTTCCCGCACTTTAATCTTATCATC
TACACCTACAAAAAAGCTCTACTTTGTCATTTATTTTCTACTTCATCTCTGTATGGCATC
TATCTCTATATATATAAAAAAGCGCATCTGTTTATTATAA
Chr coordinates Chr XII from 993434-1000129
w3c xhtml validator w3c css validator