Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IMD3
Systematic Name YLR432W
Strain S288c
Description Inosine monophosphate dehydrogenase, catalyzes the first step of GMP biosynthesis, member of a four-gene family in S. cerevisiae, constitutively expressed
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IMD3 YLR432W
GTTTAAGCAAATAGTGATATCCTTCCGGATGCTTGTCACCTGGGAAGCCGAATTTACATC
AGACAACGCTTTTTCGTGAAGCCCGACCAGAGTGCCTAAGTATTGCAGAATCTGCTCCTT
TTTTTCTAAAACCTGATTCAGTTCCATATTTACTTCTTCACTTTATTTTGTTACCTTATA
GAACAACGAGGTTAAAATGTGGAACAAGAAAACGAAAATAATCACTTGAACTAAAACGTA
CTCTATCCTTCACTTTTCCATTCCTTAGCCGGTTCTCCAATAGATATATACAGACGTTCT
CTGTGTTCTATTATTTGTATATGATTTACACTATAAAAAGACTATCTATACCTTTTGTTA
ATTGCGCACCTAAACGCCAGAGCTTACGCCCTTAAATTTTTTGAACATATGCGCTGATAC
CCTACAAGTTGTCCTAGGGCTAGGATATCGGGAAAAAAGAGACAAGGGAACTTGAAAAAC
CATAATTCCCAATACATAAACCTGTTACTTGATGGCTAACAAGATGTACTTTTTTCCAGT
GACCCAGTGGCTTCTTTAACCACTATTGTGTTCATTTCTAACTCTGGTTAATTACATAAA
TATTAGCCTTCAAAGCCGCACACGTTTCTTTTTCCGAAAAATGAAAAATTTTTCACTGAA
AAAAAAAAAAAAAAAAAGAAGAAATAGAAAGGTATAAATAGTTGAATAATTTGCCCTTCC
GAGATCCAACAAGATTTTTGAGTGTTGGGACCCTTGGAGGTTTACTCCAGTTTCGTGGGC
TTGTGCATTTTCACCTAGTGTACTGGGAACTTTCTCTTTTTTACTCTATTTCTTTTCTTT
CTTGCTTCTATATAACTTAACTTAGAAAGACTTTCTAAACTCGCAGAAAAGCACGTCATC
TCATCTGTCTCACTTTTATTCTAAGGAAAAGAAGTCATCGACAGGTTAACAGCAGTAAAT
ATTATCAGTGCAATTAATAACTCCGAAAGTAGTAAAAGCA
Chr coordinates Chr XII from 1002557-1004128
w3c xhtml validator w3c css validator