Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CAR2
Systematic Name YLR438W
Alias cargB
Strain S288c
Description L-ornithine transaminase (OTAse), catalyzes the second step of arginine degradation, expression is dually-regulated by allophanate induction and a specific arginine induction process; not nitrogen catabolite repression sensitive
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CAR2 YLR438W
ATATCCTCTATAAAAAATGTGCGAACAAGAGAAAAGACTATATAAAGAATCTATAAAAGA
GAAAGTAAAGTAGGAAAAAGAGAGAAAAAAAGAGAGAGATAAAAAAAATTGTGCAAGTCT
GTTAAAGTCTTCTCTTGGATCCATTAACCATTGTTTCGTGCTCCGCGGCAGGTTCCGCGA
CGTCCCATTTCTCGAGCGAGGACGCCTCGGTCGACATTGTTCTCTGGTTTATCAGCATAG
GTGGTAGCGAGTTAGCAGTGGGCAAGGGCGACCTTGTAAATTGCGGAACAATAACGCTCG
AGTAATCTCTAATGACACCCGGCTGTAGTGAAGCGTCCGAGGTGCTCGGCGTCCTCGATG
CATAACCCTGGTCGACCCGCTGTCTGATTCGCATACCCACAGTCATCAACTGGTCCTTGT
GGAAATCCTGTTGCTGCTGCTGCTGCTGCTCCTGTTGTTGTTGTTGTTGTTGAAGCTGTC
TCTTTGGGACGAGGCTGCTTGCCCATTCCAGTTGTGCGTCCATTAAGTCTTGTTTGTTCC
TGTATTAGTGTGTGATGTAAAGCGTGCGTTTCTTGATCTGGGTTCTCTTGCTGTTTCTTT
TTCTTTGTTTTCTTCTCCAATCCTTGCCTGTTGCTACTAGATAAATAAATACCCCACTGG
CGGGAAAAAGAAAAAGCACACACACAAACAAACGAGAAGAAAAAAGCGCGTGGTACGAGC
CGCGCTAATGAGGAATAGAACCCATGCACCACACGCAAATGTGCGCACGGACAAATTCTG
CCCTCTGTTAACGGCAGGACCTGGCGTCCCCTGCCGTTAGCGGCGCTAGCCGACGCCGTA
GTCGCGTGCCCTTGCCCTTAGCGGCTGACTGGCTGACTCGATTGCATATATAAATTGCGG
CCACCATACGTTGAGTCTTGTTGTTATATGGCGGTTGTTCGTATTACAGCAAAGGATACT
ACACCACAAGACACCACAGCAGCACAGAACCACAACACCA
Chr coordinates Chr XII from 1012501-1013775
w3c xhtml validator w3c css validator