Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YLR446W
Systematic Name YLR446W
Alias hexokinase
Strain S288c
Description Putative protein of unknown function with similarity to hexokinases; transcript is upregulated during sporulation and the unfolded protein response; YLR446W is not an essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>YLR446W YLR446W
ATGACAATTGAAAGCACTCTAGCTCGGGAATTAGAAAGCTTGATTTTACCCGCTGATTCC
ATAGTGAATGTAGTTGACCAATTCCAAGAGGAGTTGTTATCACGGCTTCAGACAAATACG
ATTTCTATGCTCCCGCAGTGTTTAGTCCCAGATAAACGATCGCGATGGAACCCTGAAGAC
AAAATTCTGACCATTGATTTCGGCGGGACAAGACTGAAATTTGCAATTATCTCTCTGCCC
CAAATCGTTATCGAATACAATGATGCCTTCGAACTTACCTACAACATCGTTGATTCGAAT
TTCTTTAATCAAATCATCTATACAATATGTACCAGGCTGGCTGCAAATGGTTATATAAAA
AAAAAGAACGAGTCATCTGAGGCGTCTAAATTTTTTGTTTCCGTGACATTCAGTTTTCCT
CTAAATCCAGAAGGGGAGGTAGTTGCAATGGGAAAAGGATTTGTGATGACTGACACCCTT
CAAGGATCCACGGTGAAACAGCTCATCCAATCTTCCTTTCACCGGATTATATCAGAAAAT
ATCGAAGAATTTTTCTGTACCATGAACGTGTGTCATGTAATAAACGATGCAATTGCAGTT
TCACTAACAAGCAAATTTATATGCGAAAACGATTCCATCTCATTAATAATAGGAACTGGT
ACAAATGCATGTTTTGAGGTTCCATACGGATATTTACCACCTTTCAAGAGAGATGCCCTG
AGAGAAACATTACCGTCAAGCTATAATAAGGAGACATTAAATTTCAAACATGTTCTCATT
AATTCTGAAATTGGCTTTATTGGTAAAAATGTCATTGCATTGCAACCGTTTGACATTCAT
GGAGCAATCTCATACGAAATGCCACTAGAGTGCGTTACTTCTGGTAAATGGCTTCCCCTA
TCATTAAAAAATATTCTATTGCAATATAACATAATCCCCAAAAACTTCCCAGTAGAGTTC
AATGGGGAACTGGTATGCCAGCTGGCAGAAGACTGTACTAATGCTTGGTTCGAAAACGAA
CATTATGCACTAATTTGTCAGATCGCACGACTATTAATCAAGAGAGCCGCATTTTATGTT
GCTGCAATTGTACAAGCTATTGATATCATCACAGGCTGCAAAAACTATAACTTTATTCAT
ATTGGCTACGTTGGATCCTTTCTCCACAATTCAAATTTTTATCGAGAGCAGATAAAATAT
TACTCCAGCATACATATTAAGTTGCAATTCTTAAATCACAGTAATCTTCTAGGCGCTGCA
ATAGCCACCTACTTGAACAAATCAGACAACCAAGTTCAATAA
Promoter Sequence
Download FASTA
>YLR446W YLR446W
GGCAATCATCTGAGAACGACCAGGATAATAACTTGGAAAGAACCAACTCATTAAAAAGTC
CGGACGTGACCAACAATATACCAAGTCTTTTCAAATTAGCCGCCGAATGGCAAATCAACA
ATCCACAGGAAACCTTCCAAAACCATATCCTGGAAAATGATGTACTCAAGAAAATTAATG
AAATCACTCATTTGATCCGGGAATCGTACAAAGACCTCTCCAGTCAAGATGGGATGATGT
CCAAACAACAACAGGAAAAGATGGATTGGGATTTGTTTTGTACTGTTCCTGTAAACATTA
TTGAGCAATATACAAAAGACATGGACGAAATATATGAAAAAATGGAAAGGCTAGCAAAAG
TAAGTATAGGTCGAAACTAGGCATCCTGTGCCATCTCAATTTTACTACGTTCTTTTACTA
ATAATGCAAATTTAATAACAGCAACAACGTCTTTGGTGTGAATCCGCTTTTCAAATAGAC
GTGGAAAGATGTGGTGACTCCATTCTCAATGCTGAAACGTGGATGAAGAAGAAAGAGCGC
CATTTAGAGTACAAAAATATTGAAATGGAAAGATCCGCAAATGAAATTAAGGAAACTATT
CAAAGACTAACAGATGATAGATGAGCCATACTCAAATATATCTGCGATATTGCTAATGTT
AGCTATTTCTCACATTTGCTTTTTTTGATTTTATTTATTTACTTTTACGACAACTGGCCT
TATCACTCGGCTCTCTAAAAGAAGTCATGTTCCCTTCGTTGGGTTAATTTTTTTTTTTTT
TTTTTTTGTTTATATGTTTTTTTTTTTTTTGCCAGGTATTGTTAGCGCCAGATAGCAAAA
AATTTTATTCAGGGATACTGAACACCGGGGAAGTTAACTGAGTATATCGGTTATCATTAT
AAACACAAGAATGTAAGCCAGAAAGAAAAATAAACGTCCACCCCTCGAACTTTCACATAT
AAGCAAGTAAAGAAAAAGTTAACAAAAGGAGGTTCAGAAC
Chr coordinates Chr XII from 1025214-1026515
w3c xhtml validator w3c css validator