Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name VMA6
Systematic Name YLR447C
Strain S288c
Description Subunit d of the five-subunit V0 integral membrane domain of vacuolar H+-ATPase (V-ATPase), an electrogenic proton pump found in the endomembrane system; stabilizes VO subunits; required for V1 domain assembly on the vacuolar membrane
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>VMA6 YLR447C
TCAATTTACTCATCTTTACACATACTTGTTGGGCAGTCATTTCGTTGAATATATTTGCTT
CTCTTCCAAGTTCAAGAAAGTAGTCAAACCTAAATGAGATTTTGCTTGAAAATTATCTAT
TGACTTTTGATCAACTGCCATATTACAGGGCCTCGCGCCTACAACATTAATTGAAACTCA
CACACTCTATACAGTGCAAATGGGCAAGCACAGGACCAGAATGAGGTTTGTTTCCGCCCA
TGTGCTCCCTCTACCGTAAACGATGCTGAACGGAAGCGCAGCCTAGAAGGCCGACTTAGC
ACGGCAAGTCCAGGTTAGGCGAGGATATTACTCGCCGCCTACGGGGAGAATCAGCACATG
GGGGCATCCTCCATCTGCGGCCGCCCGGAGGGGACGCATAACCACAACTATGTGTTTCAC
CGCCATTTTGCAGCTAACAACGATTTTTGAAGGCAAGAAAAAAAATTATGACCCATACAT
TTTGGTGCATGGGTGATATTTTGTCTTTATTATTATTAGTAACTTTCAGATTAAGACAAG
GAAGAAAGAAGGAAAAAAGGTAGGACATGAAGCATGAGAGATAATCAAATTTGCTGAATG
CTGTGATACTGGTATACAAATAGAAGTGCTGAAGTTCAAGTTATTTGGTAACATGCAAGT
TTCATTAATATTTTGTTATTATGTATTTCAAGGACAAAATGAATTGTAGGAAGATGAAAA
AGTGATTTCATCCCCCAACGATTCATACTCTGGGCCGTACCCTTCTTATCTTACAGACGC
AAAGTCAGCAGATTCTTGTATTATGGAACTAAGTAATTTCCGCGCACCTATTGTTACGCT
GATATCTGCGTACAAAGTGACGTATTTTTAAAATATCTTCGATATACTGCAAAAACAAAA
GAACAATTGACCTCTTAACCCTTTAAGGTATGGCATAAAGAACGCTAAGAGCTAGCAAAA
GAGTATACCATTCGGATCGTGTTGCTAAAGTCTTGCGAAG
Chr coordinates Chr XII from 1027893-1026856
w3c xhtml validator w3c css validator