Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PAU4
Systematic Name YLR461W
Strain S288c
Description Member of the seripauperin multigene family encoded mainly in subtelomeric regions; active during alcoholic fermentation, regulated by anaerobiosis, negatively regulated by oxygen, repressed by heme
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PAU4 YLR461W
CCCCACTATCGCTCCTTTCTTATCTGAATTGTATTTTTGAGTGGCCTAATTGTAATCTTT
TATTTTGTTTTCTAATTATTGAAGGCGGTTTCTCGAAGCATTTCACGATTTCCAAAATTC
AAGAATTGAAATTATGAACATAGAAGACAAAATACTTTTTTTATCAACTATTAATACACC
TTTCCTAGAGAACATTTTTAAAATAAAATAAAATAAAGTAGCGCTCTCTACTACCCTTAC
ACTTTTCTCCTTCATATCTGGCTAGAAAAGAGGGATTACATCTCGGAATCAAATATTTCC
CTCTGTGCAAAGTTTTAATACTGCTACTACGAACTGGTTACAATTTTATTTTTATCATAC
ACGATACTTTGAACATCAACTTCTCTCAATACCATCCGCCTTCAGCGGCTACAATTACGT
AATTGCACCAAGGCATTCGCCGAGAGTTCACAAATTGCAGACCCTAACAGTATACGACTC
CCAACACACGTTTAATGTTGTACGAATTCAAGAGATAGAAATGCTTCTTCCGCGGAAGCC
GTTTAAAGCACTGAAATTAGGCTTAGACAATAGACTTCTGTACGAGGGTCCAAATCTAAA
ATTCAGATATTCTTTTTGACCGAAAACGGAAATCACAGGCGCGCAAAAGGGTTTTTCAAG
GTACCCCGGCATCCCTATAATAGGCATTCCCACATTCTGCGCATACGAATACACATGAGT
GCCATAAAACAATACTCCACATACGAAGTCTATGAAAGATGTATGATTCGTTCAGAAACA
AGAGCATTTCCATACTGATAATGAGATTGTGTGAAAGATGAGATATGGAGGATATGTGAG
GTGCTAAATGAGCGTCTGTTAACGAATCGTTTAAATAGTGATGACTGATGAAGGCATGGG
TATAAATAGAGCTGCTTCAACTGTATGCCTTTGAGAATATGTCTTTATTCCTTTCTTTCC
TGTTAAGCTTATATCAGCACTAACAAACAAAACAAATACA
Chr coordinates Chr XII from 1062919-1063281
w3c xhtml validator w3c css validator