Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YLR464W
Systematic Name YLR464W
Strain S288c
Description Putative protein of unknown function; intron is predicted but not detected experimentally; YLR464W overlaps the verified gene YRF1-4/YLR466W and two dubious ORFs YLR463C and YLR465C
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YLR464W YLR464W
AAGCGGCTGAGCAACGAACAGAATCCTGGTTCTCCTCGACTAAGCAGATAGTTAAGATAC
TGTGCACCATGGAAATTGAAAACGAAAGTACGTACCGACTACTTTATTTTTGCAGGCCGG
AAATCAAGCGATGAATGAGACATCCTTCTGTTTTCTATGTTGTGCTTGAAGGGGACAGAC
AGTCGCTTATCTTAGTGAGATTTTGTTTGCTTTTGCTGCACCTGCATAGCGCAGATTCTG
CATCTTCTCAATAGCTTAATTATTACATTCTTAGATGATGATAAGACGAAAACTGGACAA
TCTTTTGTTTATATTGATGGATTTCTTGTCAAAAAGCATAAAAATCAACATACTATTGTT
AATTTCGAAACTTACAAAAATAAAATGAAAGTTTCCGATAGGCGTAAGTTTGAAAAAGCA
AACTTTGACGAGTTTGAGTCGGCTCTAAATAACAAAAACGACTTGGTACATTGTCCCTCA
ATAACTTTATTTGAATCGATCCCCACGGAAGTGCGGTCATTCTACGAAGACGAAAAGTCT
GGCCTAATCAAAGTGGTAAAATTCAGAACTGGTGCAATGGATAGGAAAAGGTCTTTTGAA
AAAGTTGTCATTTCCGTCATGGTCGGGAAAAATGTAAAAAAGTTCCTGACGTTTGTTGAA
GACGAACCAGATTTCCAGGGCGGACCAATCCCTTCAAAGTATCTTGTTCCCAAGAAAATC
AACTTGATGGTCTACACGTTGTTTCAAGTGCATACTTTGAAATTCAATAGAAAGGATTAC
GATACCCTTTCTCTTTTTTACCTCAACAGAGGATACTATAATGAGTTGAGTTTCCGTGTC
CTGGAACGTTGTCACGAAATAGCGAGTGCTAGGCCGAACGACAGCTCTACGATGCGTACT
TTCACTGACTTTGTTTCCGGCGCACCTATTGTAAGGAGTCTTCAGAAAAGCACCATAAGG
AAATATGGGTACAATTTGGCAGCCTACACGTAGATGAGCT
Chr coordinates Chr XII from 1066572-1067084,1067364-1067501
w3c xhtml validator w3c css validator