Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YAP1
Systematic Name YML007W
Alias PAR1, PDR4, SNQ3
Strain S288c
Description Basic leucine zipper (bZIP) transcription factor required for oxidative stress tolerance; activated by H2O2 through the multistep formation of disulfide bonds and transit from the cytoplasm to the nucleus; mediates resistance to cadmium
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>YAP1 YML007W
ATGAGTGTGTCTACCGCCAAGAGGTCGCTGGATGTCGTTTCTCCGGGTTCATTAGCGGAG
TTTGAGGGTTCAAAATCTCGTCACGATGAAATAGAAAATGAACATAGACGTACTGGTACA
CGTGATGGCGAGGATAGCGAGCAACCGAAGAAGAAGGGTAGCAAAACTAGCAAAAAGCAA
GATTTGGATCCTGAAACTAAGCAGAAGAGGACTGCCCAAAATCGGGCCGCTCAAAGAGCT
TTTAGGGAACGTAAGGAGAGGAAGATGAAGGAATTGGAGAAGAAGGTACAAAGTTTAGAG
AGTATTCAGCAGCAAAATGAAGTGGAAGCTACTTTTTTGAGGGACCAGTTAATCACTCTG
GTGAATGAGTTAAAAAAATATAGACCAGAGACAAGAAATGACTCAAAAGTGCTGGAATAT
TTAGCAAGGCGAGATCCTAATTTGCATTTTTCAAAAAATAACGTTAACCACAGCAATAGC
GAGCCAATTGACACACCCAATGATGACATACAAGAAAATGTTAAACAAAAGATGAATTTC
ACGTTTCAATATCCGCTTGATAACGACAACGACAACGACAACAGTAAAAATGTGGGGAAA
CAATTACCTTCACCAAATGATCCAAGTCATTCGGCTCCTATGCCTATAAATCAGACACAA
AAGAAATTAAGTGACGCTACAGATTCCTCCAGCGCTACTTTGGATTCCCTTTCAAATAGT
AACGATGTTCTTAATAACACACCAAACTCCTCCACTTCGATGGATTGGTTAGATAATGTA
ATATATACTAACAGGTTTGTGTCAGGTGATGATGGCAGCAATAGTAAAACTAAGAATTTA
GACAGTAATATGTTTTCTAATGACTTTAATTTTGAAAACCAATTTGATGAACAAGTTTCG
GAGTTTTGTTCGAAAATGAACCAGGTATGTGGAACAAGGCAATGTCCCATTCCCAAGAAA
CCCATCTCGGCTCTTGATAAAGAAGTTTTCGCGTCATCTTCTATACTAAGTTCAAATTCT
CCTGCTTTAACAAATACTTGGGAATCACATTCTAATATTACAGATAATACTCCTGCTAAT
GTCATTGCTACTGATGCTACTAAATATGAAAATTCCTTCTCCGGTTTTGGCCGACTTGGT
TTCGATATGAGTGCCAATCATTACGTCGTGAATGATAATAGCACTGGTAGCACTGATAGC
ACTGGTAGCACTGGCAATAAGAACAAAAAGAACAATAATAATAGCGATGATGTACTCCCA
TTCATATCCGAGTCACCGTTTGATATGAACCAAGTTACTAATTTTTTTAGTCCGGGATCT
ACCGGCATCGGCAATAATGCTGCCTCTAACACCAATCCCAGCCTACTGCAAAGCAGCAAA
GAGGATATACCTTTTATCAACGCAAATCTGGCTTTCCCAGACGACAATTCAACTAATATT
CAATTACAACCTTTCTCTGAATCTCAATCTCAAAATAAGTTTGACTACGACATGTTTTTT
AGAGATTCATCGAAGGAAGGTAACAATTTATTTGGAGAGTTTTTAGAGGATGACGATGAT
GACAAAAAAGCCGCTAATATGTCAGACGATGAGTCAAGTTTAATCAAGAACCAGTTAATT
AACGAAGAACCAGAGCTTCCGAAACAATATCTACAATCGGTACCAGGAAATGAAAGCGAA
ATCTCACAAAAAAATGGCAGTAGTTTACAGAATGCTGACAAAATCAATAATGGCAATGAT
AACGATAATGATAATGATGTCGTTCCATCTAAGGAAGGCTCTTTACTAAGGTGTTCGGAA
ATTTGGGATAGAATAACAACACATCCGAAATACTCAGATATTGATGTCGATGGTTTATGT
TCCGAGCTAATGGCAAAGGCAAAATGTTCAGAAAGAGGGGTTGTCATCAATGCAGAAGAC
GTTCAATTAGCTTTGAATAAGCATATGAACTAA
Promoter Sequence
Download FASTA
>YAP1 YML007W
CTCAAGTACTTCTGAACGGCTTCCTTTTGGGCAGAGTTGTTCTTCGACATCAATGCACTC
AAACCTGTCTTTTTACCAATATCATCACCATGTAACTCCCTAGTGAATTGGGCCTGTCTT
TTTCTCAATTCTGTTTCACTCATCTTATGCTGCCTACTATATTATTATTTTATTCTTGTT
TTTTTAAATTATGTAAAACTTAAATCGAAAGTAAAACAGATAAGGGAAACTTGAATGAAA
ATTAACAGCTTATAAATTACAAAGACGAATGGAAAGAAAAAGAGAGCAGCAGAGGATAGG
AGAAAACACCCGAACTATATAAAAAGCAATGAAGAAGTTATCGGCAACAGCAAGTATTGG
AGGTTTCTCACCAATCTTCGCATAAAACGCATGCTTCGTAAGGCGATAAAAATGAAGTGT
ACCATTGAGACGAAGTGGAGCAGTTTACAGTGAATAATACATTGTCTGCTCCTCACTTAC
TCTCGCTTCTCGAAAACTTTTTTGTATTTATCGGAAACGGCAGTAAACGACGCCAAAAAT
TGAAAATAAGTACGGGAACGAGGTACCATATACGAAGATCGGGGCTTTGTTCGGCCCTAA
ATTTTGCTGATCTTACCCTGTTGCATCTTTTCAAAAATAGTAACCAGCCCTAGCTGTTTG
GTTGATTTGACCTAGGTTACTCTTTTCTTTTTCTGGGTGCGGGTAACAATTTGGGCCCCG
CCAAAGCGCCGTCTTTGTCATGGGAACCGGAAACCCTCCGATGAAGAGTAGGAGGGTGGC
AACTGATGGATGCGTAAGGTCTTAAGAGATACATTTGCTTAATAGTCTTCCGTTTACCGA
TTAAGCACAGTACCTTTACGTTATATATAGGATTGGTGTTTAGCTTTTTTTCCTGAGCCC
CTGGTTGACTTGTGCATGAACACGAGCCATTTTTAGTTTGTTTAAGGGAAGTTTTTTGCC
ACCCAAAACGTTTAAAGAAGGAAAAGTTGTTTCTTAAACC
Chr coordinates Chr XIII from 253848-255800
w3c xhtml validator w3c css validator