Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RAD33
Systematic Name YML011C
Strain S288c
Description Protein involved in nucleotide excision repair; green fluorescent protein (GFP)-fusion protein localizes to the nucleus
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RAD33 YML011C
TCTTTCGCTAACCTTTGAGCGTCTTCTTCTGAAGTCTTGTTCAAATCTTGGTCCAGTTGT
CTATGTAATCTATCGTCTCTTCTTGCGCCTGGAGCACTTGCTTCGTCATCTTCATCATCA
CCATGGGTAATGAAACCTTCACGAACCAACTCTGAATCCTCTTCATCTTCATCTTCATCT
TCATCATCACTAACCTCAGCTTCAATATCCAAGAATCTGTTCCTCTCCTGACGACGCCTT
TTAGTTGGGGCTTCATCGTCATCGTCCTCATCATCATCATCGTCATCGTCGTCTTCATCA
TCGTCTTCATCTTTGTTATCGCCCTCATCTTTGGTATCACCATCACTGTTTTTGGTGTCC
TCTTCGCGAGGTCTCTTCCTTTCATCAGAGCCCTCTTCCTTCTTGACAATTTCATTTGCT
TCGGATGAATCCGTATTCAAAGTTGCTTGGGCATCATCTGTAGCAGGCCCGTTACTAGAT
GAAACCTGCTCTGTGGCCGCCGTTTCTGCATTATCCTCAGGTTGCTGTGGCTCAGATTTT
GCTTCTTTTTCTTCCCCATCTAAAGGGGGAATATTGCTTGTACTTTCTGCACGTTCTGTA
CTTTCCGTTGTGGTCACATTGCCACTATCAACAGTATCTTTGTCACTAGTATTTTCATCT
TTAGTGTCAGTTGACTGCGGAACCACTACGGGATCAGCAAATTGTTGATCATGGTCCTGC
ATGCTCACGTTTGTGTCCGAGTTGTCACTCATAATTATCACAACACCCGTTCCTCTTTCC
TTCTGCTGTTACCTACTTGTATGAATGGTTCTTGTCAATGCTACCAATCTTTGAACATGT
TCATCCAAATTTTTTTCTATGTCGCATATCAGGCGGGTCACCTTTAGAAGGAACAAGTAT
GAAATATACTATCATATATATATATAATAACAATTACGCATGCAGGTGTCAGCATTAAGA
AGCCGCAAGGTCACCTAAATACCTTCCGAGTTTTTTTTCA
Chr coordinates Chr XIII from 247428-246895
w3c xhtml validator w3c css validator