Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YOX1
Systematic Name YML027W
Strain S288c
Description Homeodomain-containing transcriptional repressor, binds to Mcm1p and to early cell cycle boxes (ECBs) in the promoters of cell cycle-regulated genes expressed in M/G1 phase; expression is cell cycle-regulated; potential Cdc28p substrate
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YOX1 YML027W
AAGGTGGTTTGGGCCCAATCAACATTCCATTGTTGGCTGACACCAACCACTCTTTGTCCA
GAGACTATGGTGTCTTGATCGAAGAAGAAGGTGTCGCCTTGAGAGGTTTGTTCATCATCG
ACCCAAAGGGTGTCATTAGACACATCACCATTAACGATTTGCCAGTCGGTAGAAACGTTG
ACGAAGCCTTGAGATTGGTTGAAGCCTTCCAATGGACCGACAAGAACGGTACTGTCTTGC
CATGTAACTGGACTCCAGGTGCTGCTACCATCAAGCCAACCGTTGAAGACTCCAAGGAAT
ACTTCGAAGCTGCCAACAAATAAGACGCTTGCAGAGTTGTCTAAATGACTACTTATTTAA
AATTCACTCTTTACGTTTATACCTATCTATCTATATATAAAACCCATAAACTTAATGCTA
TTCACTGACAAAACGATACACTACCGTCTAAGAAGCTATTCACACTAGCTCAGTTCTAAT
AACAATCATCGTCTGGCTCTAAAACGCGTAAACCATTCACTGCCACACTCACTTTAGCTC
TGTTGCTGCCCTTCATACGCTGAGACGCGACGCTTCTTTTCTTTCATATGATTTCCCTTC
TAGGCGACACGCCATGCCCCAAACGGGGAACACCGCGAATTCCTTCTGGTGCCCGGTTTC
CTCTTTGGGAAGGGCGTCAAAATGGTACAGCTCGCTATAGTCGCCAATTACTGCAGATGC
TTAAAGGCTTCTGCAACTGTATGTCCAACCTAGTACGTGGAAACTTCAAACGCGAACAAT
CTGTATGCTGTTTCGGGCTACTTATTGCTCTATACGGTTTTTAGTGGACACGAACTCTTG
TAATTATTATATATATATATGCCTTGGCATTTTAACAAGACTCTATGTTGTGATTTCAGT
ATGATTTGGGTGAAAACACAGTGGTGACCACAGAACAACGAGGTAACAGTTCCAGACCAC
TACCTTTCCCCTTCAATCTTTGTGATTTGATCAATTCTTG
Chr coordinates Chr XIII from 221406-222563
w3c xhtml validator w3c css validator