Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HUG1
Systematic Name YML058W-A
Strain S288c
Description Protein involved in the Mec1p-mediated checkpoint pathway that responds to DNA damage or replication arrest, transcription is induced by DNA damage
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HUG1 YML058W-A
CGGGTGGCGCGTTGGCTGACTGAGTGGAAGCTGCATTGATATTGGCGCTGGAGCCAGATT
TACCTGTATTTTCCAGCGGCAAGAACTCCGGGGTCAGCCTCTTGTACTGGGATAGAATTC
TCTCCTTCATGATGGTGTAAGTCACAAAGACTATGACGGCTAGGGCAAACAGGATCAGCC
AAAAGGAAAGAGTGAACTGAACATGGTGTAACTTGAAGAAGATCCACTTCGGAATCCTTA
AAAGCGATAAAGTTGCCAGATACCAACCGTACCTGAAGATCATACGAGAGGCACCCATAA
CAAAGTAGGACACAACCCACGAGAAGTTGAAGAGGGATGAAAGTGACCACGTCTGCGCCT
CAGAAATAATCTGGTCGGTGAGACATGTCTGGAATCTATAAGAAGTATAATTACTGGAAT
TAAAGCTGGAGCCAAGACTGTTTTTCGTGTTTTGGCCGGTATTGTTGGTGTTGTTCGTAG
TGCAATTCATTGAACGCATGCAAAAACTAGAGCCAAGCCTTTCTATTCTTTTCTTGTTTA
TTTTATATTCGTTAGAGTTTTGTGGTGTTTCTTTAACTTAATAAACTTTCGAGAAAAGTG
TCAAGTTTCCCAGATTTTTAAGATCCTTATAACCTGTAAAAAAAAAAAAAAAAAAAAAAA
AGAAGGGTTTAAATAAAAATCGGACTTACTCAAAGGGTTGAAAAGCACTTTAATATAGGT
TTTTAGTTTCGGGTAAGAAGATGTGTCAAAGGTCTCGAAAAGGAAACATTAGGGCAAATA
CGTAAAGGTTGCCTTCGTATCTCGTTTCCACAGCAACGAGAAACGAGATACGAAGGCAAC
TGATTCCCAGCATATAAAAGGCCATGAATTTTTGGCGTTTCCTATTGTCTTTTCGAAACT
ATTTCTTTCATTCCTTTCCTTTCTTGTTCTTTTACTTATAAGAAAAATAATATACGTATA
TATATAACTACAAACCACATCAGCAATAAAAAAAAACTAT
Chr coordinates Chr XIII from 158760-158966
w3c xhtml validator w3c css validator