Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NTE1
Systematic Name YML059C
Alias lysophospholipase
Strain S288c
Description Serine esterase, homolog of human neuropathy target esterase (NTE); Nte1p-mediated phosphatidylcholine turnover influences transcription factor Opi1p localization, affecting transcriptional regulation of phospholipid biosynthesis genes
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NTE1 YML059C
TGAGGCGGAATCGGGCGAAACGGGCGATGTTCCAAAACAGTAACGATATGTTATGGCTAT
TTCCTTTTTGGGACGGATGACTTCCCAAAATGGCGACCGCGGCGGGTAGTGGAGCCCGTT
TGGGCTCAGCGCGAGGTAACAAAAAAAAATTTCAAATGTTGGCCAAAAAAAAACGTCAAT
TATTCCTATGTACGAGGTCTAAACATAAAAACATATCTACTATATTCTGACGTATTTATA
ATCTATTGTTCTTTCCTATCATTGGCCTACAAAAAAAAAGAGAAGCATGCTCTTAGTTGG
AAGTATTCTTACCAATGTCAGAAAGACCGCCGCGACGTTCGACGGCAATGATGTTGGCAG
AAGGAACGTGATCCTTGGGGAATAAGTAGCCGGTCTTGACACTCTTGTTGACACGGTTGC
TCATTGAGCACAAAGTGTCTTGTAGGACGACATCGTCAAGGAAGAATTGCTTTGGGTTAA
GGCCTTGGTCCATGGTCATATAGTTTTTTTTTATTGCTGATGTGGTTTGTAGTTATATAT
ATACGTATATTATTTTTCTTATAAGTAAAAGAACAAGAAAGGAAAGGAATGAAAGAAATA
GTTTCGAAAAGACAATAGGAAACGCCAAAAATTCATGGCCTTTTATATGCTGGGAATCAG
TTGCCTTCGTATCTCGTTTCTCGTTGCTGTGGAAACGAGATACGAAGGCAACCTTTACGT
ATTTGCCCTAATGTTTCCTTTTCGAGACCTTTGACACATCTTCTTACCCGAAACTAAAAA
CCTATATTAAAGTGCTTTTCAACCCTTTGAGTAAGTCCGATTTTTATTTAAACCCTTCTT
TTTTTTTTTTTTTTTTTTTTTTACAGGTTATAAGGATCTTAAAAATCTGGGAAACTTGAC
ACTTTTCTCGAAAGTTTATTAAGTTAAAGAAACACCACAAAACTCTAACGAATATAAAAT
AAACAAGAAAAGAATAGAAAGGCTTGGCTCTAGTTTTTGC
Chr coordinates Chr XIII from 158258-153219
w3c xhtml validator w3c css validator