Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YML083C
Systematic Name YML083C
Strain S288c
Description Putative protein of unknown function; transcriptionally regulated by Upc2p via an upstream sterol response element; strong increase in transcript abundance during anaerobic growth compared to aerobic growth; cells deleted for YML083C do not exhibit growth defects in anerobic or anaerobic conditions
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YML083C YML083C
ACGCAGCTTTTGAATCGAGGGGTGGATCCAAAACCTGGGGTAGCCAGACTTTAAACACCC
TAAAACTTTGGGGTCTTTCTCCACATACGAAATTACAGATTTCCATGTCGGGAAACATAC
AGATACCGCATGTTGAGTGTCCAGTGGTATAGGCTGTCCTAGCTCGGTAGCCACTTGCGC
TGAAACCATATTATAATGTCCTATAGAAGAAGAAAATGTCAGGAAAACTTCGCCTATAGC
CCTTACTCTCTGCGTGGCCCTGCTATACTTCTTTCACTATTGAGAGGCAATTTTTTCATC
AAATTTTCATTGCGAATTTTCCAGACGGCATCGCACAGGTAGTCGGGTAACACGAAGATG
TGGTTTTTCAACTTGGTAAGGACTGCTATTAAAGAGGTCAGTCGATACAACGAGAGAAAC
TTAAACTTACACGTCTATCCTTGGCGTCCATGTTGAGCATGGTATTATCTTCACCTGCTG
CCTGTCTTTAAATCGAGGGTATCCGCACCGCAGTTCGTGACCTGTGCCTGCGTTATGCGA
GAGCAAAAGGGCCCTTAACGAGCCGGCACCTAAACGAAAATTTCAAGGGTTTTTTTGGCG
GTGCCTAATAAGGAACGCGCAGAACAATAGACCCTGCCGGTAAACGATGGCCTTGCAGTC
GTATACTGTTAAAACTGTTGAGTGGGTGAATGGCAGGGCCTAACTGCTTGCCTAGGAGTA
CCGCAGGAACGGTACGAATCGAGTGGAGACAGCAAACCTTGACGTGTGCTTGCTTTTAAA
CGGGTCGGAGAATTTACTCTTGAGCATATACGTGTGGGCATATGCATACAAATATATAAA
TACATTCGGGTGTATACGTAAATATATAAATATATAAAGTAACATATGTATATAAAGACG
AAAGATTGAACGCCATCGTGGAGAGGGTTTTCGTATGAAGGTGCCTTAAGTCTTGTGTAG
AAGTAGTTCTTTAGTTAAGATAGAACCTGGTAAAGACTCA
Chr coordinates Chr XIII from 101050-99794
w3c xhtml validator w3c css validator