Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TSL1
Systematic Name YML100W
Strain S288c
Description Large subunit of trehalose 6-phosphate synthase/phosphatase complex; Tps1p-Tps2p complex converts uridine-5'-diphosphoglucose and glucose 6-phosphate to trehalose; contributes to survival to acute lethal heat stress; mutant has aneuploidy tolerance; protein abundance increases in response to DNA replication stress; TSL1 has a paralog, TPS3, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TSL1 YML100W
TGCCGGTGAAGAAGATCCCCTGCAATAGTAGCGATAGTAAAAAGAGGCGCATACATCCTA
CGCCAGTCGATTTGTGATTTTTAATATATTTAATGCGGTACATAAGAATGCCTAATCTAG
TTTGCCAGCGAAGATATTTTCCATTGTGTGCTCAATGGACCCTGTGTTCCTGAGATCTTG
CACGACTTTTTCCTGAGGCACATGTGGCGCCATCGTCATCACGATTTCAACCATGTCACT
ATTAACGGCTCTCTTTCGATCACTACCATGTCTGTTTAACCGAGCAACGCGTTCCTCCGG
AGCCGATGGTACTGGCTCCGGAGAAGGGTCGTTGGTGGCGACCGAGGGCGCCGGTTTGGC
ATCCTGTACGGTTCGCGAGGGTACTTGCTTGGCGCCCCTGTGTTTCACGGTGTAAACAAA
CAAGCACACCATCGTCAGTATAAACACTATAGTCGATCCATCCATTTTTACTTTTGTGCG
CGTGGGTAGCCGTGCCTCGTCTGTGTGTGTGGGAATGTATAAATGTGTCCCGAGTTATTA
TTCTAAAGCGGGCACCATTGTAGTAACTTATTGCGAAATTTCTGCTCTTCTCGTCTCGCT
CAAAAATCGCGTTCAGGGTAAAAGGGGCGAAACAGAGGGCCAGATAGAAATTTCGAGAAA
AGCGGGTCACCCCGCCCCTGCATTTTGATATGGCGTATTTGGGATTGCTTGCTCGAAAGT
GTCTAAGTCCGGCTGGCGGGCCTGGCGCCCTCGCCGAAGGGAGATAGGAAGGGGCGGGGG
TCCGGGCAGCGGCTATGGTGTCAGTTACCTAGGGAAGGAGAAGGGGGTAGAACCAAGGGG
CTAGCACACTCACCCTGGGGCCCCCGTCTAGCCAAGCTTAAATATAAATACTAATGTAAC
TATAAATATAAGGATCTACCGTGTCATTGCACATCCACCCACCCGTCGATTAAAAAACCA
AACAAAGCAAAGAATACAATAGCAACGCAAGATCAACACA
Chr coordinates Chr XIII from 70624-73920
w3c xhtml validator w3c css validator