Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YML108W
Systematic Name YML108W
Strain S288c
Description Putative protein of unknown function whose structure defines a new subfamily of the split beta-alpha-beta sandwiches; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm and nucleus; YML108W is not an essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YML108W YML108W
CAAAACAATTACCACCGAAGATATAGATACAGCAAGCGTCATTGAACCAGAAGTGAGAAG
TTCAAATGCTTCCACCCTTCTTCCTGACAGCCATACTAGCCACAGTTCTGAATTTGTGGT
GGAAACTATAAGCGAGTTAGATGGCGACGATTCATTTGATATTAGTGGTGGTGATGTAAA
CTACGACGTCGAAGTGCACTCTAGTATCAGTAGAGATACGACAGCTGGACTAGAAGAGGA
TATAGGAGCAGAGAGAGAAGACAACACTTCACCTACTGCCCCTCAAATCTCAACTTTGCC
TCCAAGAAAATTGACATTTGAAGATGTCGTTAAACCAGATTACTCAAACGCTCCAATAAA
ATTCACAGACAGTGCTTTTGGATTCCCATTACCAATGATAACCAACTCTACAGTGATTAT
GTTTGACCATCGTCTAGGAATTAATGTTGAAAGGGCTATTTACAGACTCAGCCATCTGAA
GCTTAGCGATCCCGGGAGGGAATTAAGACAACAAGTATTGCTAAGTAACTTCATGTACTC
CTACTTGAATTTAGTCAATCATACCTTATACATGGAGCAGGTGGGCACTGGAGATATAGC
CTTCAATGGTGATTCTGCCTTGGGAATGATGGACAAAAATGATTCTGATGGCACAATCTT
AATTCCAGACATTTAACTCATAACTGTTTACAAGATTGATAGATACCTATATAAGGCCAC
ATATTTCAAGTATTGTAAGGATGCCCTTTTAGTGTCAAACTTCTTATTATCACGAAAAAC
GTCGTCTTTTCATGCAAGGAAGGACTACAGTATATACATATAAATATATATTTATGTAAT
TATTTTTTTCTTTTTTTTTAAATTTTCTAGCGAGAATGAAGAAAAGCCGACCTCATCTCA
TCCTATTTGGAACAAATTCGAATGATCTGTCCAATACAGCAAGGCTACCTTGCGGTTGAA
TTCTATCTCGTACTACACTAAGACGAAAGAGAAAAACGAA
Chr coordinates Chr XIII from 54793-55110
w3c xhtml validator w3c css validator