Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NDI1
Systematic Name YML120C
Strain S288c
Description NADH:ubiquinone oxidoreductase; transfers electrons from NADH to ubiquinone in respiratory chain but does not pump protons, in contrast to higher eukaryotic multisubunit respiratory complex I; upon apoptotic stress, is activated in mitochondria by N-terminal cleavage, then translocates to cytoplasm to induce apoptosis; homolog of human AIFM2; yeast NDI1 complements several phenotypes of human cell line with mutated MT-ND4, implicated in Leber hereditary optic neuropathy
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NDI1 YML120C
AGGTTTTTTGTGGGTGACTCTGGATAATAGAAAAACTGCTGGTTGGAATCGAAAGTCGCT
TTTTGTTGGAAGCTCAGGACTGGCTGCTGATTCAAATTAAACTGCGTAGGAGGCAGGACC
AGCCCACCGCTGTTATTGATGTAAGATGATTTGTTATTGAGCGTCCTTCTTGGCGACACT
GATGGACTTGGGCTCATTGCTACCTACTTTTTTTCTTACTGACCTAAGGCTGCAGGTGCA
AGAAAAGAGTAAAAGAATGTTAAAATACGTTTTGAAAGGTCTCTGTTTTCATGTACAATT
GAGGGATAAAAAAATCTTTTCTTTCTTTCAATGCGGATGATTGACACTTTCTTATTTTGT
GTTTTTATTTATGTTCTTTCCTAATCTGGAAAGCATATTAAAGACCGGCGCTACCCGGTT
AAGTAATCATACACGTGAAAAGCACGTGAACAACAAAGCACTTTAAAACTCATATACTAC
GCATTTAAAGAATGCTAAAACGGCAATTGCCACTGGGCACCATTTAAAAGGTCAATAATG
AATCTGTGACCTTTCTTTGCTATAGCATCACTACAACTATGTGTTGCTTGTCGCTAGCAA
CGAACCTATTATTCCTTCGCTTTATTGTCGAAGACCACAAAATACTCCAAAGCAATAGAA
TGTCTCTTTCCGCAAATAACTTACTCAGGGAAACAATACGAATATGTGCAGATTGCCGAT
CATTGCTGAAATGCCTCAAAAATATGCATTTTCTCATGACCTATTCATTCGGACCAATCA
TATGAAGGCATTGAACGTCCGGGTAACCACAATAAGAGTGCTCCCCCTTAGCGCTCTTGG
TTATTGCCGGTATTTGCAACGTCGACAGGGTATATATAAGATGTATAGGGCATAGTGGGG
AAGGAGTTTTAACTACCAATTGAGGAGTTTCAGGTAGGGTGTCAGTTTCATCACATCATC
GAATTACACGTTTACCCAAGAGAAGAAACTAAAAACCACT
Chr coordinates Chr XIII from 29807-28266
w3c xhtml validator w3c css validator