Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GTR1
Systematic Name YML121W
Strain S288c
Description Cytoplasmic GTP binding protein and negative regulator of the Ran/Tc4 GTPase cycle; component of GSE complex, which is required for sorting of Gap1p; involved in phosphate transport and telomeric silencing; similar to human RagA and RagB
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GTR1 YML121W
GTATACGAGCCACAATAGTAAGTGGATCTAAGTTGGCATTACCGGTGTGCAATGTGGTTG
CATCATGCTGCCAAAAAGGAATAATAATTAGCTCATAGATGAGGTCGGTTAATTAATGAG
TAATACGCACGTTTTTAATCTAGCTAATAAGCAGGCAAAACGGGAGAAGAGGGATAAGGA
AAGCCTTTCACACGACATTTGGTGCATAACTGCACCGATCTCACTGATTTCGATGGACTG
CGGCGAACCATAATCAATTGCCGTCGCTAATTTCCGCCCCACGTGCTGGAAATAACACGT
CCACGTGGAACTATTAAATTGGCATCGGGCGGTGCGGCAGTGAGAGGAACGGGTGTTTTT
CAGCCGGGCAACATTTTCTTCATAGCCGCTAGATGAGTTGAAAGGGCCCTTACGAGCAAA
TGCTGCACGTATAGGGCGCCTATAACAGCACCAACGTGCGTAATACTGATTGCTGTCATT
TCTTGGCATGTTTTCTTGGTCAAGGTCTGTGATCTCCCCTTCCGGTTGTGTCTTTTCATA
ATAATATGGTTTTTTTATTCATAATTTGGTAATAACGGTTGATAAACGAGCGGCTGATAA
ATTAGTTTCTTTTTTTTTTTAATTTTTTTTTTTTTTGATCTCATTTCTTTTTTTATTGAA
TCTTTTTTTTTTTGTAAGAAAATTAAGGTTTATTAGGCAGAGTATACCGAGTCGTTTGAA
GTCATCTCCGGGTAGTGATTTTTATCACGTGACACTTTTTTATTCCTTTTCTCTTTTCTT
TTTTAAATTTTTTTTTTTTTTTTTCATTGATTAACCGCCTCTTCTTTATCACTCTCGCAT
TCTGTCTACTAAACGGTAAAAAAACGAAGTGAAAAGTTCAATGTGGGACCCTACCCTAAA
TTGTGATTATGGTAATAATTTCTTTTTGAATAAATACAATAGGTATCTTACACAGGAGTG
AAGGCCATCAAAATCACGTTTATCAATCGACAATTTAGTA
Chr coordinates Chr XIII from 26930-27862
w3c xhtml validator w3c css validator