Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ERO1
Systematic Name YML130C
Strain S288c
Description Thiol oxidase required for oxidative protein folding in the endoplasmic reticulum
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ERO1 YML130C
TTACTGCCATTATGTAGGCCTTTTGAGTCAGCTTTGTGAAGAGATCTTATTACCTTAATT
CTTGCTGAAAAATACATCGCAATGAAGTCACTTTCGTGATGGAAAGAACACGGCGGTAAG
AATACGTTCCTTTTTGTGCTGTGTACACCCGTAAAATTGTACATTATTTATTTCAAAATA
TATAACAGGATCCCTCCAGTGTGTCTGAAATGATGCAACTCTGATACTTCAGAGTCGTAC
CCTTATTAAATACTAATGCCGAATATAGTCATCCAGTAGCCATAGTTCACACACACATTA
CTTATTCACCACATAAAGAACTAGAAATGCTTGCTAAATATCGTACCTTGAAGGTAAACA
TTAAGGCCCCCCAAAAGCATATATACATACTGGCAACACAAAAAAAGTAAATTGCCAACC
ACCTACCTTACATATGGTTTGCCCATCCTACATTACCAATACTATCAAGACATTTCTTCT
GAAACATATTCACAACTGAAACGAGATCATTTTCTTATCTATCTATTGAGTAATGCTTAC
TTTTCATATTTTCAATGAACAATAGGATATGTAGGAGAATTGATATATTCACTGCGTATC
AGAGAAAAGGTCTACTGACATTTTATGGCAAATGTATTCTACACAAATCGAGAATACCAC
AGACAATGGTACAAGACATACACAAAGAGAAGACTGTTCTAATTAAACAAATAATATTGA
GCTACCTGCTAAGTATGTCCTTTTCCCTTTGTCCTTTGGTTTCTCTTATAGAAGACCCTG
GAAATTTTTCGCATTTTTCCGGCTTTGGGCGTTAGTAAGAACAAAAAGAAAAGAAGAGAA
CAAAAAAGAAACGATACGGAGTACGTGTCATAAAAACTTGTTCAATCATCCTTGAAGCTA
AGTATAAAGAGCTTGAAAAGGTTTACCACTTAAACTGGTTATACTATTTCAAGAGTGTAA
ACATTTTATTGCATATACCACAGTAACGTGCAGGTAAAAC
Chr coordinates Chr XIII from 13174-11483
w3c xhtml validator w3c css validator