Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name COS3
Systematic Name YML132W
Strain S288c
Description Protein involved in salt resistance; interacts with sodium:hydrogen antiporter Nha1p; member of the DUP380 subfamily of conserved, often subtelomerically-encoded proteins
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>COS3 YML132W
AATTTATATACACTTATGCCAATATTACAAAAAAATCACCACTAAAATCACCTAAACATA
AAAATATTCTATCCTTCAACCATAATACATAAACACACTTAATTGCGTCTTAATACTATC
ATGGTATCATTAACTTAAAGTTCCTTAATATCGTCATACCACTATGCTCTATTCCATATA
TTGTAATATAACTGTACTCTATAGTCATACAGACGCTTTTACTTCACCCCATCTTATACT
ATTGTCATAGAATCTCACACTGACGCATGATTAAAACGAATAATTTTTACTGTAAGGGCT
GCCATCCGCGCTCTATCCTTTTGTTTGCAATATTTATATACAGAATCTCAAAACAAGCGG
GAGAAGTGCTAATTACCCAGAGGTCATGCATGATCTGAGTACCACCGTACCTCTAGGTTT
TGCTTTGATCCGTTTTACAGTGACACCGAACATAAGGGGAAGCTATTGACATGGTATCGA
AAGGTTGTCCACATTGGGAAGTAACTTGGTTCTATGAATCTTCATGTCAGATACGTAGGA
CAGACTCTTTCCTGTGTAAATATTTGTGACAGCTACGTCTATTTTCTACTAGATGTTTAC
ACAGTTTTGTCACAGGAAATCTACGCTTAAAATATGTATTTCATTCAAGCGGTAACCGCT
GTACGAGCAGTGACATTGCTGGTCGCACCCTAAATGTGAACCAACGTTACGGCACACCGT
GATGTACCCGCATTAAAGTTTTGTAAATTCGTTATTACGATTATCGAGTTGGCTAGATAG
AAAACCGGAAATGTAATGGATGCCCTTTTCGAATAGCTGAGTTTCTTTGCCTAAAATAGC
CCAATATTGTTGCCCTTTTTCTATCACGAGGTTACTGAGCCATTGCATGAACGCGCGCGC
CTCGGCGGCTTTTTTTTTCTGCTGTGCTGTATAAAAGCGAAAAGCCAGAAGTTACTATCT
CGAATAAAAAACCCCTCGAACTGCCATCTCACTACCGAAA
Chr coordinates Chr XIII from 7244-8383
w3c xhtml validator w3c css validator