Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ADI1
Systematic Name YMR009W
Strain S288c
Description Acireductone dioxygenease involved in the methionine salvage pathway; ortholog of human MTCBP-1; transcribed with YMR010W and regulated post-transcriptionally by RNase III (Rnt1p) cleavage; ADI1 mRNA is induced in heat shock conditions
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ADI1 YMR009W
TTTACGCAGGGCAATTTCGGGGACAAAGGGGGCTGAAGGAATACAATTCCGATCCAAGGC
AACAAGTAGGTCAGAACCCTTTATTAACCTGCGCTTGTTAGTGGCTTCCTTTGTACTCTG
TCCGTAATCCAGCATAGCGCTGAATTGCTGAAAGATATGGGTAGCGGTCAGATGAGAAGG
GCAATCGTCAGGACTTCTGTTGAAAAGCGGACTAAACATAGGCATTATCATTCTTAGAGT
TTTACGAGCAAATAGAATCGAGTGACTTCCGTCGTTGCTAACAGGCGCAGTAATAATAAC
CGCGGACGAAAGCCACGCAGGCAAAGAATGCTTTCGCTGAAATATCGGAGTCTTGCTATT
GTTCAGGGCTTTGCCGGTGCGTAAATAATAGGCTGAAGCGAATTTGATTTCCCGCACAAA
AAATTTTTGCTCGAGTAAGTCATACATATATCTTGCATGCGTAAAAAAAATTGCAATTGC
TGAAGATTGAACGACCGCCCACCGGTATTTTCATCTCTTCTAGATCAAGACTAACTGCTC
GTTCAGTACAAGTATTTTACGATAGTCCATATTACTCTTCAATTAATATTTTTTTTTTAT
ATTCTGGCCCGTTTTTGACACAATTTTTTCCTTCTCTTTTTCTCCCTATAAACTATGCAG
AAGTAGCGATAATCACGATCTTGTTAATGATTCACATGTGCGCAAGTCGTATTGTCTGTC
TAGATAGTGAGATGCCTTCTAAATAACAGGAGAGAGGCAAGATAGCATAACGGCGCAATG
AAGGTAATTTCTGCCAGTTTTCTTTGCATTGACGACTGAAAGGGCCCTTGTAAGAGCCGC
TCGACAGGGCGACGCCACAGTAGAGTCGCTAACACCGAAATATGCATATTGAAAAACATC
AAAGTATAAAAGAACAAAGAGGGTGGCATCTGCAGATCAAAAAAAACAATAACCACCAAA
CAAGACACTAAAAAAGGTCGTAAAAAGGTCAAAAGTTAGA
Chr coordinates Chr XIII from 284102-284641
w3c xhtml validator w3c css validator