Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SOK2
Systematic Name YMR016C
Strain S288c
Description Nuclear protein that plays a regulatory role in the cyclic AMP (cAMP)-dependent protein kinase (PKA) signal transduction pathway; negatively regulates pseudohyphal differentiation; homologous to several transcription factors
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SOK2 YMR016C
AGGGACTCCGTACCTGCACAAGCAACGCGGCATAATACATGTAGGGATACAGCAAAGATA
TTGTTTCTGAATGGGCAAAACATTGCTTTCCGCAAACGGCTTTTTCTTCTCTTTCCCACC
ACCGTGGGTCACCTTTTTCTTGCGCCTCTTATGCCAACACACTCTTCCCGTGATGCGAAT
GGTAAAGAAGTTAACAAAAAACACAAAAAATTCATATTCCGATTTCTCTGCAAAGAAGCC
TGAGCGGGAACTGCATGTCCGCTTGACTTGTCTTCCCTCCGGTTAGCTGTGCCTGCAGGG
AAACCGCAGTAGAAGGACTGCGGAAGGATCTTTTCCCGCCGTTGATGTAATCTTTAAAGT
TAATTTTTCCCTCACACAGTTTGCATTTTTCCCGCATGTTGTCCGGTTTTTCTTTCTTTT
GTTGCTTTTTCTTCCGTGGGCCTGACGGAACATTCCAAGTTGAGTGCGATCTGACTAAGG
AACTAGTAGAGGCTACCGCTCAGTAAGTTTAACAGTCGGCTAAGCATCGATCATCTCATT
CTTTGCCTTCACTCAGTTCTTCGCAATAGTACAGTGCTGCGCAATAGACGCACGTATCAG
TGATGTATTCTTTCTCTTGTCTTCACATAAAAAGTACGTAGATGTGTTGCCCGTTTGTGT
TTTATTAACTTATCGAATGTGGCAAGCCGACGATACAAAAGAAAAAAGTTCATCTTTAAC
ACTTCTTTTTGTTAGTTTTTGAAGTTTTTCCCCACTATCTTTTGCATTAGTTGTGTGTGC
CTGTGCGTGTGTAAGCCTTCTAGTATAGTTGATAATCCTTTTCCATAGCTTTTTATATTG
CAAGCAGAGAGATATCATTTTGTGCTGTTTTCATTAAACATACTTCACAATTGTATAAAA
AAAAAAAACCTTTTTGATCTTTGTTTTCAGAAATTGAAAGTGGATTTGTTAAGCACAGTA
CAAAATCATCCTTATATAACCCTGGTAAGGTCCTTTTGTC
Chr coordinates Chr XIII from 305593-303236
w3c xhtml validator w3c css validator