Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SPO20
Systematic Name YMR017W
Alias DBI9
Strain S288c
Description Meiosis-specific subunit of the t-SNARE complex, required for prospore membrane formation during sporulation; similar to but not functionally redundant with Sec9p; SNAP-25 homolog
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SPO20 YMR017W
AAAAAGCCGTTTGCGGAAAGCAATGTTTTGCCCATTCAGAAACAATATCTTTGCTGTATC
CCTACATGTATTATGCCGCGTTGCTTGTGCAGGTACGGAGTCCCTGCACGATTTTTCAAC
AAGGTCTAGATTTGCTAAGACGATGAGGCGGAGCCCGAAACAAACAAGCCAAAAACCGGA
ATTTCGCGCTTGGTGTGCTTTCGCATCTTTTCGTGTGGTGAATGCACCTGGTGCACGCTG
CGAAGGTGACGTAGCAATCCAAAAAAGGGAAGTCTAGGCGCTTTCAACCGCCCCCCACCG
TGCATGCGGATTGGTTGTCACAATTCGCAGACATATTGGCAATGTTTCCTCCCCTCCTGT
TGATGCGGGTAAGGGGTGTCTGTTATGCAGGAACAGGAAGGTAAAAATTAAATGGGCCTT
AATTCTGTAGACACTCTCTTGGGGTAATAAGGTTAAAAGCCATTGTTGAAGTACGGAATC
ATCTCTTCATTTTTTCAGCGCTTGTAAGGAATTAATCCCCAGGAAGGTGCCGATGTAATG
AGAGAAGTATTCTTGTTGTATCTCTTTGGTTCGGAGTATTTCCTTCTTTCTTTTCTTTGT
AGTTTTTATGCAAATGCAGGGAACAGAGTACCCGGTTAAGGCTGTTAGTCAGCCGCACTC
TACACAAAATTACTTGGCAAACACGTTGGTTGGGAAAAGCTTTATACTTGGCGGTGTAGT
AATTGTAAAGGATCAAGATTGTGTCATGCTAATGTGCCGCTGTGTAACAACCTTTTTGAA
GCGCGTATTTACCACCGGCAAAAGGCCATTGTGTCACATAAAAAAAAACTCCCGCCAAAG
CCAGGTTCATTTTGCATAAGATTCACCACAGTACGGAAAATACGATAAGTTAACCAGTAA
TTTGCTCGCTTTAGCTACTGATAAACCTTCTCTGTTAACACTATTATTTTTTTATTACTT
TAGATTTTTCCGTTTGTGAATAGCCATTTTTAGATATATA
Chr coordinates Chr XIII from 307489-308682
w3c xhtml validator w3c css validator