Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FMS1
Systematic Name YMR020W
Strain S288c
Description Polyamine oxidase, converts spermine to spermidine, which is required for the essential hypusination modification of translation factor eIF-5A; also involved in pantothenic acid biosynthesis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FMS1 YMR020W
GTAATCTTTTCTTTGTTCCGTGGTGGTTAAACCTTTCTCAACTATTCACGGTAAATTTAA
TATGTATTATCTACCTGCACGCAGGGATTGCCGTAACTCAAAATAAAGCTATCATGCAAA
GCTGCCAAGAAATATGGCGAACCTTAGAGTGCTCTAAGCCAAAAAATCGGCCTTCAATGC
TTCCTGAGTGCTTGTGGTGTTTGAAAATGCTGAATCATATGTTCTGCATACGACTGAGAG
ATTCTGCTTTGCAATTGGAAGCTACTCTCGGAACTGATCATGGTGATGACACCCCTAATA
GAAATAAGTTTGAGCAGTTCAAGAAAGTTGGCGATAATGATGCGGATGTTGAAGTTGATG
CTGGTGAAAGAGAAGAAAATGCTGATGAAAGACAAGAAAATCCACATAACAATAGCAAAA
GAGTACCATTAGCTACTAGGTCTCATAATACCACTAACTTCGACGGTTCAATCGCAATTT
CTCCGGAAAGTGCAGTAGCAAATCTAGGTACTGATACTGGATTGCCCTCAGATGTTCTTG
ATACTGTCAGTAAAATAGGGAACTCTCCTAATGTGTTTGATGATGATTTATTTTCCAATT
TATTATGGTTTGACCAAAATTTTGCATAAGGATTCTTTTTCTATTCCATAAAACCATTTT
ATGGACACGTTTACCTACATATTATTATATTGTATATAAGATGTTGAAAAAATTGAGTCA
ACCTCACCTTACCACATGTTGGTCCGTTGCTATGACAAACTCTCGTTTTACAAGAAGGAG
GCTCAAATTTCGGGTCACCCACCCATATACGGATGTCACGCTATGAGATCTTTTAAACAA
TAGACAATTTTTGGTATCCTAAAGATATAAAAGAGGAGTTTTTTTAAACCATGGTAACTA
TTTTCAAATTTGCTCTGCTGCAGTTTTTTATTTCTGTTTTTCTTTTTTTGTTCCCAACAA
GAAGTGAGTTAATAAAGGCAAAAACAGTGGTCGTGTGAGA
Chr coordinates Chr XIII from 315377-316903
w3c xhtml validator w3c css validator