Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MSS1
Systematic Name YMR023C
Alias PET53
Strain S288c
Description Mitochondrial protein, forms a heterodimer complex with Mto1p that performs the 5-carboxymethylaminomethyl modification of the wobble uridine base in mitochondrial tRNAs; similar to human GTPBP3
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MSS1 YMR023C
GAAGTAAATCTCGAGGATTGCTGCAGAAAGCATGTGCTAGACAAATGCTGTGAGAAAGGT
CTTATGGTTCGGCTCCAATGCCACGTACTGTTTGGAAAAGGTTTCATACCTGCTGCTATT
GCTCTTTTCAAAACTATGCCCATTCTGTATATATAACTACAGCTTTCTTTTCACCAATTC
TTTTCAGATTATTTTAGTATTGCTCTTTTTCAGAGGCGGGAAACTTCACTCTTTACCCGG
CTGCATATTGTAAGGACCTTTTCTATAATCACGCATTAAAGCGACTGTAATTTATATCTA
ATAGGATAATAATTTGCCATTAATTATTCATCTTGTTGCGTCTACAATCATTCTATTCCG
TATTCTTTATGTCAAGGCATAAGAGACCTTGGTGTTTACTTTTCATCTTTCCGTAACGTT
TTCTATAAACAGTAAAATTGATGAATCTTTGGAACTCCACCTTTCTTAAAGGTAATAATA
TGCCATCCATATCGGAACGAATGGGGATTAATAATAAATGAGTTGCTATAGTAGCAATCT
AAGTGCTGACATCGTATACGTCTGAATGTGAATGTGCCGATTCCAGAAAAAAATATTCTA
CTTGCAGTTCAGAAAGTACTGAGGCGGCGTTAAAGATCTATTAGATTGATAATCTTCTGA
TAGTTGTATATATATATATATATATATATGAGTAACACGGGTTGCCACATGTCTTCAAAT
TGGTTTCATTAATAAAAGTTTAAAAATGTATCCTACATTTATGTTTTCTATACTTCTTCA
AAGTCTTCAATACAAATCGGGCGTGTGGCGTAGTCGGTAGCGCGCTCCCTTAGCATGGGA
GAGGTCTCCGGTTCGATTCCGGACTCGTCCATTTTTTATTTTTTTGGCTAACTAACCCAT
ATATAACGTCTTTTACGAGGTTACATGAAGATACAGCAATATTCCATACGACTGCTATCT
ACTTAGAGAATGTTATATATGGTTAATAAGTATTCTATTT
Chr coordinates Chr XIII from 321017-319437
w3c xhtml validator w3c css validator