Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YMR027W
Systematic Name YMR027W
Strain S288c
Description Putative protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to the nucleus and cytoplasm; YMR027W is not an essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YMR027W YMR027W
TTCTTAGAAACGCTCTCTTGGGCCATTTATTTTCAGTTTCATCGCTGCTGAATATATTAT
TCATTGATATTTTCTCTAATATTTCATCCAACTTCGCTGTGATATAGGGGAGAATAATTT
TTTCCAAAAAAATAACACTCTTTTGCTGTTGATTCAGCTGCAAACCTTGGGGCCATTCAC
TCTGGCCCTTTGGATTTAAACATTGTGTTAAGGCAAGATTTCTGTCCCTCGAACTAAATA
GTTGCAATCCATAAAACCGATCAATAAACGTAGAATTGTATGTCTTTAGATGATACCATT
CAACAAACCCTTTTATCGCTTGAAACCACTCAAAAAAGTACTTGTTCAGCCGCAAAGTAT
ACCTGTTAGGGAAGTTCGCCACTAAATGATTTGCCAGTAGATAACGGATGGATGCGGGCA
GTAACGAATCGATTTCTTGTGATGACATTATCTCAAAGATAGTCGGATACAATGGTTCTA
ATCCCACCCCATTTCGACCGCTTGTTGAAGACCCTCGACTAGATTGTCCTGCAGACGGTA
GGTTTGAATAAAAGCTCATCACTTGACGACTACCTTCCTTTCCTTTGCTTTATTTTCCCT
GCTTATTCCCTTGCTTCTTCTGGAGCCTTCATGCAAAACCGTTTCTCTACCTAATGTGAT
TCTGCGGTAAGCATTGCTCTTAAGCATCTGAATGAGACGAAAGGATGACTCCACACTAAA
TTGTACCTCTCTTCTCCAGTGACTGAATTGGAGGTTACCATTGCCAGTGACGGTAATCGT
CCACATCGATGATTTCTTAGTATAACCCACACACCTCTCAGACATAGAGGCCCCAGGTGC
AACGTGATAGTATAACTGCCCGGAAGTAGAAATACAACTATTCCCTTCATATTAAAAGAA
TAAAACTTCATTTGAACTCTTTAAAATTTAGTGGTTCATTGTGGTCCTTGTGTAAACGGA
AAAAAAGGATATTACGGTAGTGGGTAGTACATAACAAGAG
Chr coordinates Chr XIII from 325877-327289
w3c xhtml validator w3c css validator