Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RCH1
Systematic Name YMR034C
Strain S288c
Description Putative transporter, member of the SLC10 carrier family; identified in a transposon mutagenesis screen as a gene involved in azole resistance; YMR034C is not an essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RCH1 YMR034C
ATTTGAATACCGGGGTCACTTCTAAATTCATAAAAATAAGCTGATTTTCATTCTAAAATG
GCTCTTTTGCTAATGCAGTCTCTACCGGTACTCAGTTTGAGATCCGTTCCCCACCTGGAG
GGTGGCCAAACAATTGTTATAGCTTTCCCTATGACCAACCCACTGGAAATGGGGCCAAAA
GTATTGCTATCAATCGAATGAAAATAATTGTCCCCTTCGACCCATATGTGTCCCCTGGGC
AGGTTCACTTGAGGTTTAGGGTATGGAAACTTCGTGTCAATGGTATCAAACGGTAAACCT
TTAACCCTTTTGCAGTAAACTTTCCGAGGGTTTGTAGGAGCTTTGAAAAGGATAATGTCA
TCTCTAGATAAATTACTTGGGTTCTTGACTCCAAACTTCCAAAGCAGCACCCAATCTGTT
GCCAGCGTTTCCGTTTGCGGGTTCAGCGTAGGCTGCATAGAGGTACCTTTAACTTGCGCA
ATATGGACCACATTATTATTGATTGTTAGAAGTACCGGAACCCATGAAATTGCTATTAGT
GTGTTTCGTAAGAATCTTTTTGATGATCCGGCTCGAAACATTACTGTACAGTACAATGCA
ACAGCTTCATGAATAGCAGCACGCCTTCGTTAACAAGCACCCATCTAGTCATTCAATTAA
GGCACTTGTTTTTTCCATTTTTTTCAGTAGCTCGGAACTTAGCCTCGCTCTCCTTCCGAG
CTTGATCTTCCACAGTATTTCGATGACATTGGTCTACCCGTAAGTCTGAGCTCCAACGAA
CAGCCAGAAGCTAAGAAAGCATAAAAAAGAACCGAACCACTTTAAAATCTAGCAAATTTT
AACCTTCAATTATATAAAGAGAGATTTATAGCTTTTTATTGCCTGAAACCGTCTATGCTA
CCTGAATCACCTTCGCACCCTTTTCTACGATATATCCCAACTCTGACATAACTTGCAAAA
AGAAGGAAGACACACATTTAATACACCTACTTAGTGCCAA
Chr coordinates Chr XIII from 340722-339418
w3c xhtml validator w3c css validator