Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ARG80
Systematic Name YMR042W
Alias ARGR1, ARGRI
Strain S288c
Description Transcription factor involved in regulation of arginine-responsive genes; acts with Arg81p and Arg82p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ARG80 YMR042W
TGCAAGTACACCAAATCGAGATATGTAGTGTGTAATCTTTCGCACGATCTGTGAACACTA
AATCTCACGAAATCTCTAGAATAGTTAAACTCTTCCGCACCAATACGCCCAACCTTTGTG
CATATAAAATAAGTGTCTCTGGGAAATTCATTCCTTAAATTGGACAGTGCCCTACCATAA
AGAACCTCACTAGGGCCATAGTAGGGAGAAGTGTCAATTGCATTGATACCATGCGAAAAT
GCGTATTTGATTATGTCTTCCAGTGGAATGGATTCTGGCTCATCTGTATATTGCTGGTTC
AGTATTGCACCTCCTAAGACTAAAGGAGAAACCGAAGCTAAGTCGAATGGATTCACTTTT
TCATTAACCATCTTATAGTCTCCGTTGTTACTCTTTTATTTATGTGTACTCTTCCTTCCT
GTTAACAGAGTAGATAAATATAGGCTTTAAACTTACCGTGTACTGAAACCCAGAAGGCAG
CTTTCTTTTTTCCAGAAAGTAAAATAATGACAAAAAAATCGACTACATATGCACAATGCT
AAGTTATATGACACTTTCTTTCTTATCCTCACTTATCCATAAGACACCCCTCTTCTTCAG
AGAATTTGGTAAGCAATTTCATGTATTTCCATGAGAATGGGCTCGCATCCCAGAGCGCAA
CTAATATATGAATATAAGCGGATTTAGCTCAGTTGGGAGAGCGCCAGACTGAAGAAATAC
TTCGGTCAAGTTATCTGGAGGTCCTGTGTTCGATCCACAGAATTCGCATTAATTTTTTTT
TACTTTTCATTCGTTTTCCTCTTTTGGTGATGAGCAGCATCACAGAAGCGGGTGGGTCAT
CCATTATTAGACGGTAAGTGAAAAAAATTTGATGATTCAGGTGAACCGCTATGGAAAGGC
ACGTAGTTCTACTTACTCCTAGCAAGTAGCTATGCGATTTTCCTGCGCCATTTTTTTTCC
CACATTAGTTACATACACTCTCTAAAGAATATTGCTAAAT
Chr coordinates Chr XIII from 352603-353136
w3c xhtml validator w3c css validator