Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SEN15
Systematic Name YMR059W
Strain S288c
Description Subunit of the tRNA splicing endonuclease, which is composed of Sen2p, Sen15p, Sen34p, and Sen54p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SEN15 YMR059W
GAGAGATCGTACATATGATGATGCCCTAGGTGAAGTTCCTCACAGTTTCGATCCGGACAA
CCACCCTGCCTTCCCAGAATACCCAATGAGAAGAGATACTTTATACGTTAGACCACAATC
CAATTTCGTCATCAGGTTTAAAGCCGATAACCCAGGTGTTTGGTTCTTCCATTGTCATAT
CGAATGGCATTTGTTGCAAGGTTTGGGTCTTGTTCTCGTGGAGGATCCTTTTGGTATCCA
AGATGCTCATTCTCAACAACTCAGTGAAAACCACTTAGAAGTTTGCCAGAGTTGCTCTGT
GGCCACTGAAGGTAACGCCGCTGCCAATACACTGGATTTAACTGATTTAACTGGTGAAAA
TGTTCAGCATGCCTTCATTCCTACCGGTTTTACCAAAAAAGGTATTATTGCCATGACATT
CTCCTGCTTTGCCGGTATTCTTGGTATTATCACAATTGCAATTTATGGTATGATGGATAT
GGAAGATGCGACCGAAAAGGTTATTCGAGACTTGCACGTGGACCCTGAAGTCTTGCTAAA
TGAGGTTGATGAAAATGAAGAGCGTCAGGTAAACGAAGATCGTCATTCCACTGAAAAGCA
TCAATTTTTAACTAAAGCCAAACGGTTCTTCTAATAAAGGAAGATCATGTATTTTGCGGT
TAACCTGTTTTTTTTTTTTCGGTCAAGGGTTCCAAATGCATTTGCATGTAAAGTGAATGC
CCTTGTCTTACTTAATATTACATAGACATATACTTAATAATCTACCACGTTTCAAATTCA
ATAATGCATGCTTCTTGGCGGTTTTTGACATGAGATCCTCATCTGTCACGAGGCTGATGT
GCATACTTTTACTTTTAATCGATGACATGATCAGTTTCTTTTGAACAAAAAGCCGTTATG
GGTTGAAAAAAAGTGAAAATGAAAAAGTCATCAGAAATATATGAAAGATATAATAAATTG
TCGAAGAGAAATTACGTCGAGGAGGTTGAGGAAAATAAGA
Chr coordinates Chr XIII from 391099-391485
w3c xhtml validator w3c css validator