Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ARG7
Systematic Name YMR062C
Alias ECM40
Strain S288c
Description Mitochondrial ornithine acetyltransferase, catalyzes the fifth step in arginine biosynthesis; also possesses acetylglutamate synthase activity, regenerates acetylglutamate while forming ornithine
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ARG7 YMR062C
TGTGAATGCCAGTGAAATCGGGTGAACCACTAATAAATTGGAGACGACCACTTTTGAGTT
CGATGGCAGGGTCAAAACGTGCCCGGAGGAGTCGACATCTGTACTGTCATATCCTATCTT
CATTTTCGTGCACATCAATTCTTGGTTTTGACCACGTACACACCAGCCAAACAGGCCATA
ATAGTGGTTTCTGAATGACGATAACGATAGGTACTTGGTCACGGGGACGGTTATTAGCGG
AAGTATTTCGAACATGGTTGTGATTGCTAGCAAAAACACCACAATATGGATCATGCTAAC
CATTCTCCTCTTTTCCTCAATGAATCTGTCTCAACCGTATAAATCTTTGTTTAGAAGGAC
GTCTCTACTCATTTCCCGGTTCTCAACGCTCATCACTATCTATCTATATTCATTGTTTCT
TAGCTTATACTTGCGCGCGCCGCTGGTGAAAATCAAACTATAGCGAGATTCGACAATAAA
TTGGCAGTTACTTTTAGTGATAAAGAAAAGTCATGTTTTGTATATAGTCATAGCATGCTG
TGTTGTAAATGTGATCTGTCTGAGACGTGTCAGTAGATCATAAATTTACAAACATTAAAA
TACATTTTTCATCGCTGTATAGCAAAAGTAATCTTATACTTTGTTGGTATGCTGAAGTAA
AACACAGGGCTCTTGGCTTCACCCCCACGCTGTATCATAGAATAAAGAGAGTAGTGATGC
AATAGGGCCGTGGTTAGACCCAAATTGAAGGTAGCGTTGATAGTAGTACTAAGTGAGAGT
GCTTAGCAATCATTATTGACGGTGTTTTCTTGGCGAAGGTCTTTTTCTACTGCGATGGAC
AGGTAGGATGACTCACTGCGTAATTCGTTGCCAACTTCTTTAGTCGTCGAGTATATAAAA
GCCTCATCCTCGGCTCGCCGCACAAAGGTGACGATTTTTGGGCTAGTATCAGCAATACTT
CTATTCCCTTTATTTAAAGAAGTCCAAAATTCAACATAGC
Chr coordinates Chr XIII from 396379-395054
w3c xhtml validator w3c css validator