Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ARG7
Systematic Name YMR062C
Alias ECM40
Strain S288c
Description Mitochondrial ornithine acetyltransferase; catalyzes the fifth step in arginine biosynthesis; also possesses acetylglutamate synthase activity, regenerates acetylglutamate while forming ornithine
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ARG7 YMR062C
TGTGAATGCCAGTGAAATCGGGTGAACCACTAATAAATTGGAGACGACCACTTTTGAGTT
CGATGGCAGGGTCAAAACGTGCCCGGAGGAGTCGACATCTGTACTGTCATATCCTATCTT
CATTTTCGTGCACATCAATTCTTGGTTTTGACCACGTACACACCAGCCAAACAGGCCATA
ATAGTGGTTTCTGAATGACGATAACGATAGGTACTTGGTCACGGGGACGGTTATTAGCGG
AAGTATTTCGAACATGGTTGTGATTGCTAGCAAAAACACCACAATATGGATCATGCTAAC
CATTCTCCTCTTTTCCTCAATGAATCTGTCTCAACCGTATAAATCTTTGTTTAGAAGGAC
GTCTCTACTCATTTCCCGGTTCTCAACGCTCATCACTATCTATCTATATTCATTGTTTCT
TAGCTTATACTTGCGCGCGCCGCTGGTGAAAATCAAACTATAGCGAGATTCGACAATAAA
TTGGCAGTTACTTTTAGTGATAAAGAAAAGTCATGTTTTGTATATAGTCATAGCATGCTG
TGTTGTAAATGTGATCTGTCTGAGACGTGTCAGTAGATCATAAATTTACAAACATTAAAA
TACATTTTTCATCGCTGTATAGCAAAAGTAATCTTATACTTTGTTGGTATGCTGAAGTAA
AACACAGGGCTCTTGGCTTCACCCCCACGCTGTATCATAGAATAAAGAGAGTAGTGATGC
AATAGGGCCGTGGTTAGACCCAAATTGAAGGTAGCGTTGATAGTAGTACTAAGTGAGAGT
GCTTAGCAATCATTATTGACGGTGTTTTCTTGGCGAAGGTCTTTTTCTACTGCGATGGAC
AGGTAGGATGACTCACTGCGTAATTCGTTGCCAACTTCTTTAGTCGTCGAGTATATAAAA
GCCTCATCCTCGGCTCGCCGCACAAAGGTGACGATTTTTGGGCTAGTATCAGCAATACTT
CTATTCCCTTTATTTAAAGAAGTCCAAAATTCAACATAGC
Chr coordinates Chr XIII from 396379-395054
w3c xhtml validator w3c css validator