Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name AVO2
Systematic Name YMR068W
Strain S288c
Description Component of a complex containing the Tor2p kinase and other proteins, which may have a role in regulation of cell growth
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AVO2 YMR068W
GAATGGAATATCTTCGCGGTTGGTCTTATTCGCCACCGGAAAATTACTACTTTTAGATAA
TTCTAAGTTGACACCCGTTGGTAAGTTTAGAAGCCTCCATGGCAAATCTAATGGCACCGG
TTTATCCAAATGTATCAATGACCAGTCGTTTGACGAGGTGTGCAGTTGAAAGAATTGTAT
GGATTGGTGTAACACATCGTTTAGTGTTGAATTCAACGAAACTTTACATTTGAAAAGTTG
GAAGTTATACTTCACGGTAACCATAGGCATTGTATTGTGCGCTTATTAGTCTGCCTTGCT
ATTCTTCGCAGTACGTAGATTTATCTTAGTTTTTGCATTTTTTGGTTTTCTTTTTTTTTT
GCCACACATAGTACAATAAAAGAGAACTTGAATCTTTGAAGAAACGTCTAAATTAACATC
GAAGATAGAAGACAGGGAAACATCTAGGATTGCAAGAAATAGTGCTGAAATTTTGTAATA
AAGTTGCAAGAAATAGCATCTAGCGTTTTATAAGGCGTACATCTTTCTTGGCAAGAGTTC
CAAGAGAAAAGAGGAGCAAAACAGCGGTTGAGGCGCCCGCTATCTTGAATATTATACAGT
TTCTTTAAAAACGCTTGTACAACACTGCATAAACATGGACAAATTATTGAAATTGTTTCA
AGATATTTCCCATATCATATTCCAATAGCGTTACTCTCTCATCGCTTATTCTGGAATCAT
TATTTTAATAAAGATAACTCACACGATATACGTGTACTGAGCTGACCTTTATACCTACCC
TTACCTGCTTATTCCTGATAAAAATGTTCGTGCAACTAATTGTTTGATTTCTCTTGCGGC
CCGGTTATTCCGGAGTTGATACTTTTTTTCTTCTGTCTTAATTACGTTTTTTTCCTCTAG
ACTTTTTTGATCTGGTACAATTGAAAATGTATAAATCAACTGGACCCTAAAAATAAAAAA
AAAAAACGCCCATTAGAAAAGAGGATATATTGAACAAAAG
Chr coordinates Chr XIII from 406304-407584
w3c xhtml validator w3c css validator