Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NAT4
Systematic Name YMR069W
Alias NAA40
Strain S288c
Description N alpha-acetyl-transferase, involved in acetylation of the N-terminal residues of histones H4 and H2A
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NAT4 YMR069W
TGGGTAATGGACACTAATGGCGACACGCCGCTGCATGTATGCCTGGAGTATGGCAGTATA
AGTTGTATGAAGATGCTTCTCAATGAAGGTGAGGTGTCCTTGGATGATAATGTCAGGGAC
AAGGGAAATTGGAAGCCAATAGATGTAGCACAAACGTTTGAAGTAGGTAATATATATTCA
AAAGTGTTAAAAGAGGTGAAAAAGAAGGGGCCACCGTTGGGTGCAGGCAAAAAACCAAGT
TCATTCAGAACTCCTATACTAAATGCGAAGGCCACTTTCGAGGACGGGCCTTCCCCAGTT
TTAAGCATGAATTCGCCATATTCGCTCTATTCCAATAATAGTCCGTTGCCGGTATTACCA
AGAAGGATATCAACGCATACAACAAGCGGTAACGGTGGGAATCGGAGGAGTTCTATCACA
AATCCAGTATTCAACCCACGAAAACCAACCTTGTCTACGGACAGTTTTTCGTCAAGCTCA
AATTCCAGCTCGAGACTAAGAGTGAACTCCATCAACGTCAAGACTCCAGTAGGTGTGTCG
CCCAAGAAAGAGCTTGTATCTGAATCAGTACGACACAGTGCAACACCAACAAGTCCGCAC
AACAACATCGCGTTGATTAATAGATACTTGTTGCCTAACAAGAGCAATGACAACGTGAGA
GGAGACTCACAGACAGCTACAATCAACGATGACGGTGGCGGCGGCAATGGCGGTGATGCC
ACTATAGGAATGGGACTAAGAAAGGACCCGGACGATGAGAACGAGAACAAGTACAAGATT
AAGGTAAACAATGGCGAGCCGAGGAGACGAGTGTCACTTCTGAACATACCCATCTCAAAA
TTAAGAAATAGCAATAACACGCGTGCAGAAGATTGAGAAGACTACTACGTATTTTTTTTT
ATATGCATCCTTTTTTCCACATATGTATGCGCGGTGCGCGCGCGCCATTAAAAGATTTTT
TTCTTAGCTCTTTTTCTTTTTTCTTTTTCTTTCCACTGAG
Chr coordinates Chr XIII from 407709-408566
w3c xhtml validator w3c css validator