Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MOT3
Systematic Name YMR070W
Alias ROX7, [MOT3+], [MOT3]
Strain S288c
Description Nuclear transcription factor with two Cys2-His2 zinc fingers; involved in repression of a subset of hypoxic genes by Rox1p, repression of several DAN/TIR genes during aerobic growth, and repression of ergosterol biosynthetic genes; can form the [MOT3+] prion
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MOT3 YMR070W
GGGACAACGGCGTGCTAGGTGCATTTACTTCATTCATGCTTACAGAGGAGACGGGTCTCG
TCGAAGGTGACGCTTTACACGAGGTTAGCGTGCCCGTGATATACCTTTACGAAGTACATG
TAGCTAGCGCGCACCGCGGGCATGGAATCGGTCGGCGGCTACTGGAGCATGCACTGTGCG
ATGGCGTAGCTCGACACACCCGCCGCATGTGCGACAATTTCTTCGGTGTAGCACTCACCG
TATTCAGTGATAACACTCGGGCCCGGCGACTATATGAGGCGCTTGGGTTCTACCGCGCTC
CGGGATCACCCGCACCAGCATCACCCACAATTCGTCACACGCGACATGGTGGGGGACGTG
TAGTCGTGCCCTGCGATCCGCTTTATTACGTATATTGCCTTCACATGCCGTGAAAGCCGA
CAGGGACAACGCGCGATAAAAAAAAAATTAAAAGTAAAACTACGTACGCGGCGGCGCGAC
TCGAATCCTTGACTCCGACTGAGGAGACCCGAACAACGCTCCCTGCTCTCCGCCTTCGGC
GCCTTCCGATAACTGCGCACGGCAAGGAGTAGTGGCGATAACGGTGTTTATTGCCGGTTT
TTTCGTTTTTCTTCTTGATTTTCTTCTTTTTTTTCCTCAAAAGATGTGCTGTAGCCTCCG
CTGTTGTTTTTTTTTATCCTACCAAGGCGCATCATCCTGTCATGATCTGCGCTGGATAGT
ATTTATACTACTACTCCGTCTGGATTTACTAAACTTTGTCTCTCTTTTGATGTAAAGTTA
AAGAAGAATTACGAAAAAAGAGAGAAAAAATAGAAACAAATAATAGGAATTAAGGCCTTG
TAGCAATCAAAAAAAAAAAGAAAAAAAAGGAATTTTTTTTGGAAGAAAACTTGAACAAAA
CAATTCCTCAAGAAGGAACAGGTACAAGAAAAGATTTAACAGAAGGAAAACTAATAGGCA
ACAGTAGGCAAATAGTAAAGGGACATATCATATTTGAGCA
Chr coordinates Chr XIII from 409154-410626
w3c xhtml validator w3c css validator