Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YMR084W
Systematic Name YMR084W
Strain S288c
Description Putative protein of unknown function; YMR084W and adjacent ORF YMR085W are merged in related strains
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>YMR084W YMR084W
ATGTGTGGCATTTTTGGCTATTGCAATTTTTTAATTGAGAAGACAAGAGGAGAAATCATC
GACACTTTAATCGAAGGGTTACAGGCATTGGAGTACAAGGAATATGACTCCAGTGGAATT
TCGATCCAAGGTGATGAGCTGGAGTCTCTCAATATTTATAAGCAAACCGGTAAAATAAGC
AGTTTGAAGGAAGAAATCGACCTTTACAATCTTAATAAGAACCTGCCCTTTATTTCGCAT
TGTGGCATTGCCCATACTAGGCGGGCAACACATGGAGGGCTAAGACGTGCAAATTGTCAT
CCACATAACTCAGATCCATCTAATGAATTTGTTGTGGTACACAACGGGGTTATTACCAAC
TTCGCTAATTTGAAAGCCTTATTGATGGCAAAGGGCTATGTGTTCAAAAGTGACACTGAT
ACCGAATGTATTCCTAAACTGTACAAACACATTTATGATACAAGCATTGAACTCGGGTAC
AACCTCGATTTCCATGTATTAACAAATTTAGTACTTAAAGAATTGGAAGGCTCTTATGGT
CTGCTATGCACTTCTTCTCATTTTCCCGATGAAGTGGTTGCCGCAAGAAAGGGTTCCCCG
TTAGTTATTGGTGTTAAAGGTAAAACTGACATGGACGTAAACTTTGTCGAGGTGGAATAT
TTGGATCAAGAAGAAGACTACTTGAAGCTTAATACTCAAACCAAGAGTTCTGGTAATGTC
TTGGCTGCCGCACCTGTAAAATATAACACTTGTTTAAGGAAGTCACCCCCCTTCGTTCAC
AATACCTGA
Promoter Sequence
Download FASTA
>YMR084W YMR084W
TCTCTATCTACGGAATATGTTAGACCATGTGGTACCGTCGTTTTGGTTGGTTTGCCCGCT
AACGCCTACGTTAAATCAGAGGTATTCTCTCATGTGGTGAAGTCCATCAATATCAAGGGT
TCTTATGTTGGTAACAGAGCTGATACGAGAGAAGCCTTAGACTTCTTTAGCAGAGGTTTG
ATCAAATCACCAATCAAAATTGTTGGATTATCTGAATTACCAAAGGTTTATGACTTGATG
GAAAAGGGCAAGATTTTGGGTAGATACGTCGTCGATACTAGTAAATAATAGCGTGTTACG
CACCCAAACTTTTTATGAAAGTCTTTGTTTATAATGATGAGGTTTATAAATATATAGTGG
AGCAAAGATTAATCACTAAATCAAGAAGCAGTACCAGTATTTTTTCTATATCAAGTAGTG
ATAATGGAAATAGCCCAAATTTGGCTTCCGTCGACACATAGAACGTTTGAGAGACATTAT
CACCATCAAGCATCGAGCCGCCCAAACCTAACCGTATAAGTTTTTTCACGTTTTTGATTT
TTCCTTGCACACTTCGATATTACTCTCACGATAAAAGGGCCGAAGAGAATATTTTTCTTG
AACATCCAGAATTTTAATTCGGAGAAATTTCACAAGCCGCCGATTTAAGGGTCCTGTGTT
CTTAATAATCAGCCTCTCTCAAAGCAGGTAAGAGGCAGTCTTTCTTTTAACAATAGGAGA
CATTCGAACTAAAACATCAGCCCCAAAAATGCGCTTGAAGGTCATTAGGATTTGGATTTC
TTCCTCATTTTTAAAGGCGCCCCTTTTCGTTTTAGTCATGCTGGGCTAGACTAGCACGTA
GTGTATGGAATCAAACTGATGCCGTCCCCTGAATTATATTTACAATTCAGAAACGTCTTT
GAACATTTATAATTAAATTATAAAACAAAAGGAATTTGTAAAAAAGACTTTCAAAAGATG
ATCCAATAAACTAGATTAAAAACCCAATATAAGAAGAAGA
Chr coordinates Chr XIII from 436628-437416
w3c xhtml validator w3c css validator