Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PDL32
Systematic Name YMR087W
Strain S288c
Description Putative ADP-ribose-1''-monophosphatase that converts ADP-ribose-1''-monophosphate to ADP-ribose; may have a role in tRNA splicing; contains an A1pp domain
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PDL32 YMR087W
AATTTTGAGGAGGCATTGAGTGAAAGCTATAATGGGCAAGCTAGCCAGAATAGCACAAAT
GTGAATCGAACCGATACAGCACAGGAGTTTTTCAAATATTTGGGTCATTCATCAAGATTT
GCGGATTCAGACTCAGAAGATGAGTCCCAATTTTTCAACCAAGGCCCATCAAAATACAAC
ACAGAAACAGAAGGCAATAAAACCAGCGGTAACAAAAATAGTAATGGTGGTAACGGTGCT
TTTTCGCTTTTCAAGAGCAAAAGTAAGCAAAAGGAAAATAATGTGGTTTCCCCTGGAGTC
TCAAGTCCTAATCATACTACCACCGATCCTGCCATTACAAGTAAAAAGGTGGACAAGAAA
TTCAGCGGGTTATCTTTAAGAGCTGCCAGTGAAGCTGAACCTGCAAAAAATTCAAACCCT
TCGATGACCAATAGGTTACGCTTCTCTAGTAATCCAGAGAACGGCGAAAGCAGGCTCCCA
CAAGCACAGGAAGTCAGCGTTACAAAAGAAAAGAAGGGTAGTTTCGGCAAAAAACTGAAA
AAAATCTTTGGTAGAAAGAAATAGGGACTCTCGGCAGAAATTCTCTCCTTGTACAAGTTA
TGTATTTTATTCTTTTTCGTGCTCGTTCAACTTCTGAACGATGGCTTCCATGCACTGTAA
CATATAAAGGATTTTTTAATAATGAATAATCAAGAAATCTCCATTTTATATGCTTTTTTT
TTTTTGCCGTTTCCACTGCAATCAATGGCGATATAATCGGATGAACAATAAATATTCGTG
TTCCTATTCGTGTTCCTATACGTGTTCCTAGCAGCAAACAATAACAGAAGAGAAGCATTT
GATTTTCGTAAAAACTTCAGGTGTGGGTGTTTCTTATTAACGGTTAAACTTTACGAATTG
AATCCCCTATGTATAATGGTCCATAATACATCTTAAACCACCAAGCCATCTTCGTAATTT
TGAACTGGGAAAATTGGGAAAACTGCAGACATTCATAATC
Chr coordinates Chr XIII from 442527-443381
w3c xhtml validator w3c css validator