Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SNO1
Systematic Name YMR095C
Strain S288c
Description Protein of unconfirmed function, involved in pyridoxine metabolism; expression is induced during stationary phase; forms a putative glutamine amidotransferase complex with Snz1p, with Sno1p serving as the glutaminase
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SNO1 YMR095C
TTTTGCAATGTCATCTTCGCTCTTCAATTGTTGGCACGCCTTTATCTCCTCTGTAATTCT
CCTTATATGCTTGACGGCTTCAGAGACATCGCCCGTTCCAGCTTCACCCTTGGTACGAAT
CATAGCGGCGCCTTCATTAATTCTTCTCAAAGCTTCACCTAAGTCTTTAGCGCCACAAAC
AAATGGAACTTTGAATTTGTCCTTTTCAATGTGGTGAGTCCAATCAGCAGGAGTCAAGAC
TTCACTTTCGTCAATATAGTCAACTTCCAATGCCTCAATAATTTGAGCTTCAACAAAATG
GCCAATCCTTACCTTAGCCATGACGGGAATGGAAACGGAGTTCATGATGTCCTTAATCAT
CTTCGGATCTGACATGCGGCAAACCTTTCCTGACTTACGCATATCTGCTGGGATGGATTC
TAATGCCATTACCGCACATGCACCAGATTTTTCAGCTATTTTTGCCTGCTCTGGAGTAAC
AACATCCATAATAACGCCACCTTTTAACATTTGGGCGAGACCACTCTTGATCTTAAAGTC
TTCTCCAGTCATCGTGATAATTAACTGAATATTAGTACTGTGTATATTTGCTAGTCGTTC
CTAAAGGTTTCTCCAACAATACCATAGACTTCGTCCATAGCTCTCAGCGTCCTCCTATTT
ATATCGAAAATGGTACTTCGCAGCCAGAATTACAGACGTAACTAACGGTGCGGCAGAGTG
TGTCAGAGTCATGAAGAAATGGCGGCGCTACCTGAAAAGTAGTGAAAAAGCCCGGCTTTC
AACCCTTACCCTTGTCGGCTGAGTCATTATGTCATGATGAGCTATTCCAACTAGTGCCAT
AAATTCCAACTGAGTCAGTAAACGGCATTTATCAGCAATAACTGGTCACGAACTCTTTGA
ATGTTTTATTCTTTCTTCCAAAAATCACGTTGATGCCACCAGGTTTTTTTTTCTTATTAT
TTCATTTCGTTAAATAGAAAGAAAAACCATATCTTAAAGT
Chr coordinates Chr XIII from 457959-457285
w3c xhtml validator w3c css validator