Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SNZ1
Systematic Name YMR096W
Strain S288c
Description Protein involved in vitamin B6 biosynthesis; member of a stationary phase-induced gene family; coregulated with SNO1; interacts with Sno1p and with Yhr198p, perhaps as a multiprotein complex containing other Snz and Sno proteins
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SNZ1 YMR096W
TCCATTCACTGGCAATTCATATAAACTTTTAACCGCGATAGGATCAAGAATTCTCTCGAT
CACGGGTGCGCGAATAAATGTAGCAGGAAAATTATCACAGCCAGGTATGAAATTGGAAAA
ATCACACTTTTGTGTAAAAGATTGAGCTTGTCTTCCAAATGCGTTTCTTCTCACGTCGAC
CTTCAACACACCTAAAGTCTTTACTAGGGCACTTTCGTTTTCTAATTGCGCGCTTAAAAA
GATGAGACCAGCACAAGTACCCCAAACTACCTTTTCCGGATTATGAACAAATTCGTATAA
ACAAGGATATAAGCCTGTTCTTTGAGCGATGAGGGACATCGACGTAGATTCTCCTCCGGG
AATAATTAAGGCGTCGCACTGGGCTAGATCCTCAGGAGTTTTTACAGTTTTGATTTCTAT
CTTTATTCCGTAGTCGTTTTCAGCCAAACACCTTTTTAAATGGTTGGTATGCTCCAAAAA
GGCACCTTGCAACGCCAAAACCCCAATTACTTTCATCGACTTTCCGGACATTGTACTGTG
GGTTTTGTGCATACTTTAAGATATGGTTTTTCTTTCTATTTAACGAAATGAAATAATAAG
AAAAAAAAACCTGGTGGCATCAACGTGATTTTTGGAAGAAAGAATAAAACATTCAAAGAG
TTCGTGACCAGTTATTGCTGATAAATGCCGTTTACTGACTCAGTTGGAATTTATGGCACT
AGTTGGAATAGCTCATCATGACATAATGACTCAGCCGACAAGGGTAAGGGTTGAAAGCCG
GGCTTTTTCACTACTTTTCAGGTAGCGCCGCCATTTCTTCATGACTCTGACACACTCTGC
CGCACCGTTAGTTACGTCTGTAATTCTGGCTGCGAAGTACCATTTTCGATATAAATAGGA
GGACGCTGAGAGCTATGGACGAAGTCTATGGTATTGTTGGAGAAACCTTTAGGAACGACT
AGCAAATATACACAGTACTAATATTCAGTTAATTATCACG
Chr coordinates Chr XIII from 458408-459301
w3c xhtml validator w3c css validator