Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SRT1
Systematic Name YMR101C
Strain S288c
Description Cis-prenyltransferase involved in synthesis of long-chain dolichols (19-22 isoprene units; as opposed to Rer2p which synthesizes shorter-chain dolichols); localizes to lipid bodies; transcription is induced during stationary phase
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SRT1 YMR101C
GTAACGACGATGGCATAATGTCAGATGTAGAGTCGTCTTTGGGCTACAATTCTAAACCAG
GCTCAATTTCTAATGCTTCCGCCACCAGTGCTATCCCAGATGTCGTTGACGCAATTGGAA
CGATATTGATCAGTACTGATAACGTAGGGACTATTCGTGTGTTTAGAGCAGATATGCCCT
CTGTTATAAGAAAGCGCGTGTTACTCAAACTAGAAGAATACAATAGAGAGGTTCGGAGAA
GGTTTAACAGTTCTGATTCTTTGCATTCTTTGAGTCGAAGCTTCAACTCGAGAGCGAAAT
CAAACTTGGCTGGCCAACCGGCAGCGGCGTATACTAATACTGGAAAAGGCTATGCAACGG
GACGTGGATACTCTAATATATGTCCCAAAAGCAGTACATCACTAAAAACACTCGGCAGTA
ATGCACAGCCAAGAACACCAAGGGAAAGCATGTCATCTATTTTCTCCAATGCACATGGGC
CTACCACTCCAACGAGCGCAATGAATTTACCTATCCGTTGCAATGTTTGTAACGGTTCAA
GGTTTGAGGCTTTTTCTGGTGCTAATGACCAACAAGATAGAAACTATTATTGCGTAGACT
GCGGTACAGTAGTTAATAACTTCCGCTAACGCTGATGGAGTATTTTTTTTCCGTGGATGA
TACCTTTAAATGCATATTAATCTTCGTACATAAAGTAAAGAAACACGATACACTTAAATA
AATTTTAATCTAATAATTAATGAACGCTAACAATGAGCCTATCATTTGTTGCCGATATAC
TATAACGTATCTCTTCGAAAGAACAAAACGGAGTGAGTGCCTGTTAAGGGTAACTACTCC
AAACTGAGTGGACCTCGGCGGCTAAAGCTATACTTTTTCTGTTATTTAAGGGACCTAAAA
ATACACACAGAGTAGATTAAGATTTGGTGCACTTTTCTCAATTTATCAACTTATAAAGAA
CAGGCTGCCTTTCAAACATAGGACGTTTCTGTTGACCATA
Chr coordinates Chr XIII from 469476-468445
w3c xhtml validator w3c css validator