Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YMR102C
Systematic Name YMR102C
Strain S288c
Description Protein of unknown function; transcription is activated by paralogous transcription factors Yrm1p and Yrr1p along with genes involved in multidrug resistance; mutant shows increased resistance to azoles; YMR102C is not an essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YMR102C YMR102C
TTTCAAAAATGGATAGTTCAAGTAGATTGCGATACGCACTCCGTTACTATTGTGGTTAAC
GGGGACAAGAAGAACTACAGAAAATAGAATGGTCCGCAGAGGCTGCGCTCTTCTTTTAGC
AACTCTCACACGACTTATGTTGCTTATTCATTTCTTTTACAGCATTATCAGAATTCTTCC
ATCTACGGAATTGAGATCAAAGACCGACCTGTTGTCGGCCGAAGGACGGACGCTTATACC
CGCGGATGTCAAAGCGAAGCCCGCGGGGCGCAAGTCGAGGTTACCGGAATTCGCCAAACG
GCAAAGGACCCTTGCATTGCCTGAAAGGAAAGATTCGCTTTTCTGTTTGTTGCCACTTTT
CTTACATAGTCTGGGCCGGGAGCAGCTTATTTCTTCCGCGGATGATCCTGGATTTCCTTG
CGCGGGCTCAGCCATGGGGAGCCTTACCTAGTCCCGTAAAGGGAAAAAGCTAACCTCATT
CGCCTCACAGGGTGAAAGCGTGAACAAAAAAAAAAGAAAAGCTTAATGATTAAAATTTAC
AGTATATATATATTTGTATTTACGTATTAAACTATATATAAATAGATATGTATGCCGAAA
AAGTAAAGTCTGGGTGATGCCTAGTCCAATCTTTCTTACTACTGTCCAGTTTCTATCGTA
GCAGTTAATTATACATAGAACTGTGTAAATTCAACGCATTAATTTTTTTTTTTTTCACTT
TCGCAGTTAGGGGGGACACATTTTTTTTGCCCTTTCTTAAGCTTCGTAAGCGAGTTACAT
CATTATTTCTTCCTGGGATACAATACGCGTTCGTACAAGTCACAGCTGGACCGTATAGGG
AACAAGACTGCAACTCTCTCCAACTTGTTAAACAGAGGAGGAAAAGAAAGAGGGAAAAGA
GGAACAAAGACAATCAAAGAAAAAGAATAGAAAGCAGTTGCTGAGCTCTTGGCATATTGT
ATACGGTAGTGGCGTATAATATAGTACGAGAATTAGAAAT
Chr coordinates Chr XIII from 472352-469848
w3c xhtml validator w3c css validator