Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YMR103C
Systematic Name YMR103C
Strain S288c
Description Putative protein of unknown function; conserved among S. cerevisiae strains; YMR103C is not an essential gene
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YMR103C YMR103C
CAAGAGTTGACTGCCCCTTTATTGTTCCGTTGAAGTTCTCATTCCAATCTCCGGAGAAGT
TGTACCTAGTATTAGCTTTCATTAATGGCGGTGAACTGTTCTACCATTTACAACACGAGG
GACGATTCAGTCTAGCACGCTCCCGTTTTTATATTGCAGAACTATTATGTGCTCTCGATT
CATTACACAAACTTGACGTCATTTATCGTGACCTAAAGCCTGAAAACATTCTATTGGATT
ACCAAGGACATATTGCACTGTGTGATTTTGGGCTTTGCAAGCTGAACATGAAGGATAATG
ACAAAACAGACACTTTCTGTGGTACTCCCGAATATTTGGCACCAGAAATCTTGTTGGGGC
AGGGCTATACTAAAACAGTTGACTGGTGGACATTAGGTATCTTACTGTATGAGATGATGA
CAGGGCTGCCACCATACTATGATGAGAACGTTCCTGTTATGTACAAGAAAATTCTGCAGC
AACCGCTACTATTTCCTGATGGATTTGACCCTGCGGCAAAAGACCTATTAATTGGCCTCT
TAAGCAGAGACCCAAGCAGAAGACTCGGCGTTAACGGTACAGATGAAATTCGTAACCATC
CTTTCTTTAAAGACATCTCATGGAAAAAGCTACTTTTGAAGGGCTATATTCCGCCTTACA
AGCCAATTGTAAAGAGTGAAATAGATACTGCAAATTTTGATCAAGAGTTCACTAAGGAAA
AACCGATCGATAGTGTAGTGGACGAGTACTTAAGTGCAAGTATTCAAAAGCAGTTTGGTG
GGTGGACGTACATTGGTGACGAACAGTTGGGTGATTCTCCTTCGCAGGGGAGAAGCATTA
GTTAGAAGCAAGCCGAAGCAAGCCGAGCCGAGCCGGACGGAATTTATAGCTATAGCCGCA
AGAGGTTGCAATTTTCAAAAATGGATAGTTCAAGTAGATTGCGATACGCACTCCGTTACT
ATTGTGGTTAACGGGGACAAGAAGAACTACAGAAAATAGA
Chr coordinates Chr XIII from 473264-472902
w3c xhtml validator w3c css validator