Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YPK2
Systematic Name YMR104C
Alias YKR2
Strain S288c
Description Protein kinase similar to S/T protein kinase Ypk1p; functionally redundant with YPK1 at the genetic level; participates in a signaling pathway required for optimal cell wall integrity; involved in the TORC-dependent phosphorylation of ribosomal proteins Rps6a/b (S6); human homolog SGK2 can complement a ypk1 ypk2 double mutant
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YPK2 YMR104C
CCAACCACGTAAGGGAAAAGGACGGTGTTTGGGCCATTATGGCGTGGTTGAACATCTTGG
CCATTTACAACAAGCATCATCCGGAGAACGAAGCTTCTATTAAGACGATACAGAATGAAT
TCTGGGCAAAGTACGGCCGTACTTTCTTCACTCGTTATGATTTTGAAAAAGTTGAAACAG
AAAAAGCTAACAAGATTGTCGATCAATTGAGAGCATATGTTACCAAATCGGGTGTTGTTA
ATTCCGCCTTCCCAGCCGATGAGTCTCTTAAGGTCACCGATTGTGGTGATTTTTCATACA
CAGATTTGGACGGTTCTGTTTCTGACCATCAAGGTTTATATGTCAAGCTTTCCAATGGTG
CAAGATTCGTTCTAAGATTGTCAGGTACAGGTTCTTCAGGTGCTACCATTAGATTGTACA
TTGAAAAATACTGCGATGATAAATCACAATACCAAAAGACAGCTGAAGAATACTTGAAGC
CAATTATTAACTCGGTCATCAAGTTCTTGAACTTTAAACAAGTTTTAGGAACTGAAGAAC
CAACGGTTCGTACTTAAAACGAATGATTTACTAATGGCTTAATGATTTTCACCTTTTTCA
ATGAATATTAACGGTAAAGAAGAAAATTTCAATTTTTTGAACACATACTTTATATACTTA
ATAGATCCATATTTCGACATATTAGCAAACGATTGCATAGGTTTCTGAGTCTTTTTTTTT
TTTTTTTCATAAGGAGGAGAATATTTTGGTTAATCGCAGTATCTTCTTCATAAGTGCTGT
TTCTAATTATATCTAATTCACGAATTTTTCCCAAATTAGCGTATCCCCGAATTCAGATTA
CCTACCCCGAGTTTTTTATTATATTTCCCTCGAGAAATCTGTAAAATGGCCGTCATCCTT
AGATTTATAAATAAAATGATAAAATTCAGCCAAAGTGCTCCTAAACCAGAATTGTTCAAC
TGGGTCAAATTATCGCGTATACAAATATACATATAGTAAC
Chr coordinates Chr XIII from 475453-473420
w3c xhtml validator w3c css validator